Examination of Acute Glomerulonephritis After Streptococcus (GNAPS) With Primer of pyrogenic exotoxin B (speB) Gene of Streptococcus pyogenes Bacteria

Abstract

GNAPS is glomerular damage due to poorly managed Streptococcus pyogenes infection. The damage is dominated by toxins produced by S.pyogenes, namely streptopain or SpeB. Laboratory examination serves to diagnose S.pyogenes infection. The discovery of specific biomarkers is a priority to improve the quality of laboratory services to prevent and accelerate treatment. The design of specific primers is needed in the molecular examination of PCR method. This research used literature study from NCBI genebank to obtain SpeB gene sequence with access number L26148.1. The gene sequence was analyzed using Primer3Plus to determine candidate primers, then identified using in silico PCR amplification to determine the number of amplicons and visualization on gel electrophoresis. The results of the gene are specific to the S. pyogenes species, the homology level of the gene in the group of species tested by BLAST also shows 100%. These primers include forward primer F5' GGTGCTGACGGACGTAACTT 3' and reverse primer R3' TGCCTACAACAGCACTTTGG 5'.The primer design was able to amplify the SpeB gene region with an amplicon size of 151. These primers can be used in the examination of GNAPS by PCR method so that it is earlier to be treated so that it will reduce the mortality rate due to complications of GNAPS.