Proceedings of International Conference on Health Science, Practice, and Education

Audiovisual Media as an Effort to Increase Adolescents’ Knowledge of Free Sex

Sulistiyowati Sulistiyowati, Mahalul Azam, Yuni Wijayanti, Widya Hary Cahyati — Tue, 02 Jan 2024 00:00:00 +0700

Adolescence is a life period between childhood and adulthood, characterized by the maturity of the reproductive organs. In this period, sexual development and drive are common and reasonable. However, if they have poor control, they will follow negative behavior. In many cases, they will explore a lot of new things and most of them will engage in free sex. This study aimed to determine the effect of utilizing audiovisual media during health education on the knowledge of free sex among adolescents. This research used one group pretest-posttest design. The populations were all students of Muhammadiyah Vocational High School 1 Lamongan. The samples were 37 respondents who were obtained by simple random sampling in March 2024. In this research, health education using audiovisual media was the independent variable, while adolescents’ knowledge of free sex was the dependent variable. A closed-questionnaire was employed to collect the data. The collected data were then analyzed by using the Wilcoxon-signed rank test. To conclude, audiovisual media are very beneficial in improving adolescents’ knowledge of free sex, and it is suggested to use in the similar activities.

Factors Influencing Cognitive Development In Early Childhood: A Systematic Literature Review

Thu, 02 Jan 2025 00:00:00 +0700

Apart from problems in cognitive and psychosocial development, nutrition also affects inadequate nutrition in children aged 4-5 years which can cause stunting, which is a condition of chronically stunted growth. Stunting can have an impact on children's physical and cognitive development, including their brain development and cognitive abilities. Therefore, it is important for parents and caregivers to ensure that children receive balanced and sufficient nutrition to support their growth and development properly. So cognitive development is intended so that children are able to explore the world. The aim of the research is to determine the factors that influence the cognitive development of early childhood (4-5 years) in terms of several literatures. Search for relevant literature data sources using Google Scholar and Sciendirect using the keywords: “Factors influencing development” + “Cognitive development” + “Psychosocial development” + “In children”. The search articles were selected using inclusion and exclusion criteria using population, intervention, conclusion and output (PICO) analysis. Apart from that, the articles were taken from the last 7 years and are in full text form. The results of searching the Google Scholar and Scientdirect data bases. The result literature review From the 5 journals, the results obtained mostly stated that there were several factors, namely psychosocial, nutritional, environmental and genetic. The conclusion regarding the factors that influence cognitive development in early childhood (4-5 years), such as psychosocial and nutrition, is that these two factors play an important role in shaping children’s cognitive abilities. Psychosocial factors, such as social interaction, emotional support, and cognitive stimulation from the surrounding environment, can help enrich children’s learning experiences and influence their brain development.

The Relationship between Motivation, Compensation, Rewards and Workload with Nurse Performance

Muhamad Ganda Saputra, Bambang Budi Raharjo, Intan Zainafree, Chatila Maharani — Thu, 02 Jan 2025 00:00:00 +0700

Quality health services are inseparable from the role of medical and non-medical personnel, including nurses. Nurses are one of the most potential human resources in hospitals in providing health services in hospitals. Therefore, nurses are required to have a good performance based on the nursing care provided to patients. Nurse performance will be a determining factor in shaping the hospital’s image in the community. Factors affecting nurse performance are classified into individual, psychological, and organizational factors. This study aimed to analyze the relationship between motivation, compensation, rewards, and workload with nurse performance. This research used analytic survey with cross-sectional design. The population were nurses at Lamongan hospital of 153 people. A total of 61 people was selected using simple random sampling. The data were analyzed by using the Chi-Square test. The results showed a relationship between motivation (p=0.000), compensation (p=0.002), reward (p=0.000), and workload (p=0.004) with nurse performance in Lamongan hospital. Lamongan hospital has to adopt policies to improve nurses’ performance such as preparing appropriate reward system and determining suitable workload.

MODELING THERAPY ON MEDICATION ADHERENCE IN SCHIZOPHRENIA PATIENTS

Thu, 02 Jan 2025 00:00:00 +0700

Non-adherence to medication is very prevalent in people with schizophrenia. This contributes to a high number of relapses, increasing the burden of care on the family. Many therapies have been applied to improve patient medication adherence. The purpose of the study was to analyze the effect of modeling therapy on medication adherence in patients with schizophrenia. The study employed a pre-experimental design with one-group pre-test post-test approach. A total of 30 schizophrenia patients who were not adherent in taking medication were given modeling therapy intervention in accordance with SOP. The data were collected using questionnaires and observation sheets. The results showed that before being given modeling therapy, almost all samples were at a low level of adherence of 25 patients. However, after being given modeling therapy there was an increase in patients’ adherence, in which 11 patients were at a moderate level of adherence, and 19 patients were at a high level of adherence. There is an effect of modeling therapy on medication adherence in schizophrenia patients in the Lamongan Health Center area.

The Influence of Family History, Obesity and Psychosocial Stress on the Incidence of Hypertension in Women of Childbearing Age in the Working Area of Puskesmas Pembangunan, Garut Regency

Liliek Pratiwi, Siti Harnina Bintari — Thu, 02 Jan 2025 00:00:00 +0700

Hypertension is one of the most common risk factors for death in the world. Ischemic heart disease and stroke are often caused by hypertension. Grups of diaseases such hypertension, heart diabetes, stroke, and cancer account for 73% pf deaths in Indonesia. In 2022 the number of people suffering from hypertension is ranked 10th and hypertension in the first row in the Garut Regency Development Health Center Area. This study aims to identify the relationship between the incidence of hypertension obesity, and psychososial stress, in women of childbearing age in the area of Garut Regency Development Health Center. This study used observational analytic with case control study and retrospective design. All women in the working area of Garut Regency Development Health Center subjectsof this study. In this study, the respondent sample consisted of 68 people who were considered as the case group and 68 people who were considered as the control group. All respondents were taken through consecutive sampling technique. Univariate, with chi square test were used to analyze the data. The results showed that obesity had the greatest influence on the incidence of hypertension in the working area of Garut Regency Development Health Center, with p=0,003 (OR-2,95 CI 95% 1,438 6,058) and psychososial stress p=0,008 (OR-2,95 CI 95% 1,438 6,058). Family history did not affect the incidence of hypertension; however, obesity was the most dominant factor affecting the childbearing age with OR=2,95 (p<0,05), health workers at Garut Regency Development Health Center are advised to provide adequate information about hypertension to the community so that they can avoid hypertension by routinely controlling their blood pressure, following a healthy diet and lifestyle, and exercising regularly.

The Effect of Educational Intervention About Screening Preeclampsia on Midwive’ Knowledge, Implementation and Incidence Rate of Severe Preeclampsia

Yoga Paripurna — Thu, 02 Jan 2025 00:00:00 +0700

Preeclampsia affects 2-8% of pregnancies globally, leading to 60,000 maternal deaths and over 500,000 preterm births. The incidence of severe preeclampsia in Rehatta Hospital, Jepara, Central Java, April 2023 to April 2024 was 79 cases. The placement of midwives in village areas is an improvement in the quality and distribution of services in reducing the mortality rate of mothers and children under five. The purpose of the study is to assess the impact of an educational program on midwives' knowledge, preeclampsia screening activities at primary health facilities, the number of pregnant women requiring ICU/HCU care and maternal mortality rates. Experimental study of pre-post-test one group design by educating 68 midwives at primary health facilities in Jepara Regency. The effectiveness of education was assessed based on differences in midwives' knowledge levels, preeclampsia screening activities at primary health facilities, the number of pregnant women requiring ICU/HCU care and maternal mortality rates. The study was conducted between April 2023 - August 2024 at Primary Health Facilities and Rehatta Regional Hospital, Jepara Regency. Data were analyzed using the SPSS statistical tool edition 29. Educational interventions can raise midwives' knowledge levels considerably (p<0.001). The distribution of preeclampsia screening actions varied significantly between the pre- and post-education stages (p<0.001). Giving midwives education raised the chance of preeclampsia screening implementation 4.30x (RR 4.30; CI95% 2.52-7.35). The distribution of referrals between the study groups showed a significant difference (p=0.002), with intended referrals being substantially more common in the post-education phase. The chance of intended referrals increased by 7.41x (RR 7.41; CI95% 1.70-32.29) when midwives received education. Giving midwives education was able to lower the number of patients needing ICU/HCU care (22.8% to 9.1%) and the mortality rate (3.8% to 0%), even though there was no statistically significant effect. When midwives at primary health centres received education, their level of expertise, preeclampsia screening practices, and planned referrals all increased significantly.

The Impact of Child Marriage: Literature Review

Siti Rofi’ah, Haryono Haryono, Intan Zainafree, Eko Farida — Thu, 02 Jan 2025 00:00:00 +0700

Marriage is an important moment for every couple with a physical and spiritual bond to form a harmonious family. Marriages performed before the age of 19 can be considered a violence and a violation for children's rights. Child marriage occurs due to several factors. Child marriage will have a multi-dimensional impact because it can have major implications for development, especially regarding the quality and competitiveness of young people's human resources in the future. This research aims to analyze the impact of child marriage. The research design used a literature review of four articles obtained from Semantic Scholar, Science Direct, and SpringerLink. The impact of child marriage on the physical domain includes maternal and child deaths due to risky pregnancies and nutritional status problems. The psychological domain is depression, suicide attempts, and communication patterns. The social domain includes divorce, school drop out, and domestic violence (KDRT). The economic domain is in the form of poor socio-economic conditions. It is hoped that these findings can be used to provide appropriate interventions for adults in health promotion efforts regarding to delay the age of marriage.

Sexual Education to Realize Reproductive Health: A Bibliometric Analysis from 1991-2024

Esa Risi Suazini — Thu, 02 Jan 2025 00:00:00 +0700

Sexual education has not been an interesting topic to study in realizing optimal reproductive health. Therefore, it is necessary to have a systematic visualization as a scientometric report, so as to increase researchers' interest in studying the theme. The purpose of this study is to find out the latest literacy developments, analyze collaboration, and make strategic decisions regarding the theme of sexual education and reproductive health research. This type of research is descriptive quantitative using bibliometric statistics. Research data were obtained from Scopus indexed journals and through the Publish or Perish reference manager application for Google Scholar indexed journals. The research was conducted on September 17-20, 2024. The keywords were "sexual education" and "reproductive health". Articles analyzed from 1991 to 2024, for Scopus indexed articles, the document type of the article is in English and can be accessed without payment, besides that there are no restrictions on articles, so 566 relevant articles were obtained. Google Scholar indexed articles found 999 articles. Data were analyzed and visualized using the VOSviewer application. Bibliometric analysis shows the development of research on sexual education for reproductive health is still limited, collaboration between researchers is still lacking, the trend of increasing research has been seen. Publications based on the most keywords are "health reproduction", the country that dominates this publication is the United States, the dominant author and affiliation is the World Health Organization. In conclusion, there is a great opportunity for researchers to raise the theme of scope, targets, diseases, promotive and preventive policies related to reproductive health.

Evaluation of Environmental Health Information System Using Context, Input, Process and Product (CIPP) Model

Nuryanto Nuryanto, Ratih Lukmitarani, Bunga Nuur Primayu Utami — Thu, 02 Jan 2025 00:00:00 +0700

The Primary Health Centers (PHCs) and District Health Office (DHO) of Banyumas as the provider of environmental health services and information systems, is obliged to provide data and information in a systematic, informative, complete and timeline. The implementation of the environmental health information system in Banyumas Regency has problems, namely low accuracy and completeness. The study was to evaluate the environmental health information system in The Banyumas District using the CIPP model. Types of qualitative research with applied qualitative research methods. The informants of 16 people included Sanitarians (10 people), the Head of the PHCs (4 people), the Coordinator of Environmental Health in DHO of Banyumas (1 person), and the Coordinator of Health Human Resources in DHO of Banyumas (1 person). Data collection techniques through documentation studies and in-depth interviews. Evaluation of environmental Health information system includes aspects of context, inputs, process, and product. The data that has been collected then analyzed through stages: data reduction, data presentation, and conclusions. The results of the study show that there were problems in the environmental health information system in Banyumas District, including: limitations of sanitarian, errors/maintenance applications, unintegrated system, uncomprehensive applications and weak of monitoring. The completeness and timeliness of reporting were 47.5% and 57.5%. The environmental health information system in Banyumas District has some problems that have an impact on the low quality of data and information.

Factors That Influence Midwives' Compliance in Completing the Partograph

Erna Kusumawati, Siti Istiana — Thu, 02 Jan 2025 00:00:00 +0700

Partograph monitoring during labor is an intrapartum intervention that significantly reduces perinatal mortality. This is because the partograph helps health workers identify slow labor progress and provides an early warning system for early referral and can also help initiate appropriate interventions in a timely manner. In fact, the partograph is not used optimally, both in terms of incomplete filling, incorrect interpretation that affects clinical decisions and the absence of supervision from the leadership. Objectives methods cross-sectional design using Binary Logistic multivariate analysis with the help of SPSS Statistics 24. Results there are 5 variables tested, namely the availability of partographs, partograph policies, supervision of partograph completeness, training, partograph filling skills, through 4 stages it was found that supervision had the most influence on midwives being able to fill out the partograph correctly with Exp (B) / Odd Ratio of 136.432. Then followed by the skill or skill of midwives in filling out the partograph correctly Exp (B) / Odd Ratio of 45.987. Conclusions require drills or many periodic case studies for midwives to acquire the correct partograph filling skills and to be able to draw conclusions to make decisions and supervision from the leader or coordinating midwife in terms of availability, data accuracy, correct filling methods and appropriate actions according to the findings of the partograph results.

THE EFFECTIVENESS OF HEALTH PROMOTION USING AUDIOVISUAL MEDIA ON THE KNOWLEDGE LEVEL OF POSTPARTUM MOTHERS ABOUT POSTPARTUM BLUES AT RS. ROMANI SEMARANG

Siti Istiana, Aniatul Janah — Thu, 02 Jan 2025 00:00:00 +0700

From a psychological perspective, there are moments when a postpartum mother experiences feelings of sadness related to her baby; this condition is known as postpartum blues or baby blues. The incidence rate of postpartum blues in Indonesia ranges between 50-70% of postpartum women, while in Central Java Province in 2021, 30% experienced mild postpartum depression and 6.7% experienced moderate postpartum depression. Research findings indicate a low level of knowledge among postpartum mothers regarding postpartum psychological disorders, particularly postpartum blues. This condition is attributed to inadequate and incomplete information about postpartum blues received by many mothers. Therefore, one strategy to enhance mothers' knowledge and understanding of postpartum blues during the postpartum period is through health promotion activities. Understanding the effectiveness of health promotion using video media on the knowledge level of postpartum mothers about postpartum blues at RS. Roemani Semarang. Pre-experimental research design using a one-group pre-post and post-test design, conducted from December 2023 to January 2024 with a sample size of 43 respondents. Nonprobability sampling technique using purposive sampling. The average knowledge score before health promotion was 63.6628, and after health promotion, the average knowledge score improved to 88.3721, indicating an improvement in knowledge about postpartum blues after health promotion using video media. There is an effect of health promotion using audio-visual media on the knowledge level of postpartum mothers about postpartum blues at Roemani Hospital Semarang, as shown by the Wilcoxon test result with a p-value < 0.005.

Determinants of Computer Vision Syndrome (CVS) Incidence: A Case Study on Lecturers during Online Learning

Dewi Sari Rochmayani, Oktaviani Cahyaningsih — Thu, 02 Jan 2025 00:00:00 +0700

Computer screen exposure during online learning has increased the incidence of Computer Vision Syndrome (CVS). The study was conducted to analyze the determinants of CVS in lecturers during online learning. A case-control study design was conducted on 60 people consisting of 30 people each in the case and control groups. A questionnaire with a Google form was used for data collection. Data analysis was carried out univariately, bivariately and multivariately. There were 5 variables that were proven to be significant as risk factors for CVS, namely: 1) length of work with computers (OR = 18.693; 95% CI = 1.487 - 234.955); 2) length of continuous computer use (OR = 54.281; 95% CI = 2.523 - 1167.92); 3) length of rest after using a computer (OR = 31.060; 95% CI = 1.884 - 512.062); 4) viewing distance to the monitor (OR = 34.640; 95% CI = 2.263 – 530.240); and 5) the position of the top of the monitor to the horizontal eye height (OR = 17.555; 95% CI = 1.778 -173.296). These five risk factors together will provide an 83% chance of experiencing CVS. The conclusion of the study is that exposure to computer monitors experienced by lecturers during online learning will increase the risk of CVS.

Knowledge of Labor Support Regarding Counter Pressure Massage for Pregnant Mothers in Mothers in the Third Trimester at UPTD Puskesmas Tongauna Utara, Konawe Regency

Murti Wuryani — Thu, 02 Jan 2025 00:00:00 +0700

Labor pain is a physiological condition that is generally experienced by almost all mothers during childbirth. Childbirth pain, if not addressed, can affect the mother's condition, leading to fatigue, feelings of fear, worry, and stress. Stress can lead to weakened uterine contractions, resulting in prolonged labor. One of the efforts made is through counter pressure massage. Counter pressure massage involves a firm, steady push by placing a fist on the lower back area when the mother is experiencing contractions. Therefore, the researchers are interested in studying the Knowledge of Labor Companions about Counter Pressure Massage for Pregnant Women in their Third Trimester at the UPTD Puskesmas Tongauna Utara in Konawe Regency. To determine the knowledge of labor companions about counter pressure massage for pregnant women in their third trimester at the UPTD Puskesmas Tongauna Utara. Using a quantitative research type with a descriptive design and employing a cross-sectional approach. The sample in this study consists of all labor companions of pregnant women in their third trimester at the UPTD Puskesmas Tongauna Utara from February to May, totaling 33 pregnant women. Out of 33 respondents based on their level of knowledge, 20 respondents (60.6%) had low knowledge, 10 respondents (30.3%) had sufficient knowledge, and 3 respondents (9.1%) had good knowledge. Regarding knowledge about massage counter pressure, 3 respondents (9.1%) were aware of or had heard about massage counter pressure, while 30 respondents (90.9%) were unaware of or had never heard about massage counter pressure. The majority of birth companions had low knowledge about massage counter pressure, totaling 20 respondents (60.6%).

The Relationship between Mother's Readiness and Motivation for Exclusive Breastfeeding in Semarang Regency

Thu, 02 Jan 2025 00:00:00 +0700

Exclusive breastfeeding coverage in Semarang Regency Semarang Regency is in 5th place with the lowest exclusive breastfeeding coverage of 56.5% (Semarang Regency Health Office, 2022). One of the reasons for the low rate of exclusive breastfeeding is due to the failure of mothers to breastfeed their babies due to a lack of readiness and motivation of mothers. Mother's readiness in exclusive breastfeeding includes physical readiness and psychological mental readiness. To determine the relationship between maternal readiness and maternal motivation to give exclusive breastfeeding in the Semarang Regency area. This study used a cross sectional approach. This study uses a questionnaire instrument regarding the readiness of pregnant women in providing exclusive breastfeeding with a total of 21 items of questions about physical and mental readiness and motivation questionnaire. The population of this study is primigravida pregnant women in the third trimester in the Semarang Regency Health Office Work Area, which totals 56 people from 5 health centers with the lowest coverage, namely Dadapayam Health Center, Ambarawa Health Center, Bawen Health Center, Bergas Health Center, and East Ungaran Health Center in December 2023. Sample selection using Purposive sampling. Univariate analysis uses frequency distribution and bivariate uses Chi-square test. The results of the study showed that the number of respondents who were ready to give exclusive breastfeeding was 29 people (51.7%) and 27 respondents who were not ready (48.2%). Good motivation was 26 (46.6%), Sufficient as many as 25 respondents (44.6%) and less than 5 respondents (10%). The Chi-Square test showed a p value = 0.001 < α (0.05) that there was a relationship between breastfeeding readiness and motivation to give exclusive breastfeeding in the Semarang Regency area. There is a relationship between breastfeeding readiness and motivation to give exclusive breastfeeding in Semarang Regency area.

Consumption of Moringa Leaf Tea (Moringa oleifera) on Hemoglobin Levels of Pregnant Women

Anggit Kartikasari, A. Asrina, Ayu Dewi Rahayu — Thu, 02 Jan 2025 00:00:00 +0700

Anemia is a common health problem throughout the world, especially in pregnant women. Tasikmalaya Regency, the percentage of pregnant women with Anemia in 2020 was 17.65%. U.P.T.D. Salawu Health Center Tasikmalaya Regency, in 2021, the number of frail pregnant women was 127 out of 1102 pregnant women or 11.5%. The number of frail pregnant women in Margalaksana village is 12 out of 73, or 16.43%. This study aims to evaluate the effect of consuming moringa leaf tea (Moringa oleifera) on hemoglobin levels in pregnant women. This research is an experimental research with a quasi-experimental research design and a one-group pretest-posttest design, which is carried out on one group without a control group. The sample size was 20 pregnant women. The intervention that will be given is consuming Moringa leaf tea. The data analysis used is univariate analysis, and the bivariate analysis uses paired tests. The average hemoglobin level of pregnant women before giving Moringa leaf tea was 11.645, while the average hemoglobin level of pregnant women after giving Moringa leaf tea was 12.330, so there was an average increase in hemoglobin level of 0.685. The p-value of 0.002 is smaller than the research significance level (alpha) of 0.05, so Ha is rejected, so there is an influence of Moringa leaf tea consumption on the hemoglobin levels of pregnant women in Margalaksana Village, Tasikmalaya Regency.

Tuberculosis (TBC) services and facility vignettes associated with new TBC cases found in community health center/sub-center: Analysis of Indonesia Family Life Survey

Lili Amaliah, Sri Nurcahyati, Mohamad Sadli, Supriatin Supriatin — Thu, 02 Jan 2025 00:00:00 +0700

Indonesia is one of the countries with the highest burden of tuberculosis (TB) in the world. Community health centers and health posts, as primary health facilities, play an important role in the detection and treatment of TB in the community. The purpose of this study was to analyze health services and tuberculosis facilities in community health centers/health posts with new cases of TB in Indonesia. This study used secondary data from the 5th Indonesia Family Life Survey in 2014/2015. This study focused on the level of public health services with new cases of TB as the main outcome. The sample of this study used 955 community health centers/health posts spread throughout Indonesia. Univariate, Chi square and binary logistic regression were used to present the main results of this study. This study revealed that the availability of TB services in health facilities, especially community health centers/health posts and government health offices, is a crucial factor in diagnosing new TB cases. However, spontaneous contact with TB patients and a history of TB did not significantly affect new TB cases. Therefore, increasing access to services, especially in rural areas and sub-health centers, as well as support for diagnostic resources and training of medical personnel are needed to improve early detection and comprehensive control of TB.

Effect of Modisco Corn as Supplementary Feeding to Increas-ing Production and Quantity of Albumin Breast Milk

Agnes Isti Harjanti, Mudy Oktiningrum, Anifatus Saadah — Thu, 02 Jan 2025 00:00:00 +0700

Data from Indonesia in 2019 recorded that 65,8% of breastfeeding was given to babies; in 2021, there was a decrease to 52,5%. According to the ministry of health regulations records, there has been aslight increase from 4.58.595 babies, but only 66% will get sufficient breast milk in 2022. Ob-jective this study aims to analyze the relationship between the provision of modisco corn sup-plementary feeding and the quantity of albumin in breast milk. Modisco is a modified dietetic skim and cotton sheet oil mix with corn. Methods this type of research was a quantitative study, with the independent variable being modisco corn supplementary feeding and dependent varia-ble being breast milk production and increased breast milk albumin. The sample in this study consisted of 102 respondents who were breastfeeding mothers giving modisco corn twice daily for ten days of administration. Quantitative data were analysed using deskriptive and bivariate with Paired T-Test and T independent test. Results that albumin levels in the pre-test case were 35.2053 g/100ml in the case group and 17.629 g/100 ml in the control. Postest as many as 60.2018 g/100 ml in the case group and 28.2577 gr/100 ml in the control group. There is a difference in al-bumin level with 2-tiled sig 0,009 <0,05. There was an effect of increasing milk production with P-Value of 2-tiled sig 0,000. Conclusion that there is a difference in the increase in breast milk pro-duction after giving modisco corn supplementary between case and control groups.

Healthy Practices of Mother’s Toddlers in the Household Setting Related to the Incidence of Stunting in Tasikmalaya City

Sri Maywati — Thu, 02 Jan 2025 00:00:00 +0700

Reducing stunting has been the focus of the Indonesian government in the last 5 years. As stated in the 2020-2024 RPJMN, stunting is a national program with a national target of reducing stunting prevalence by 14% in 2024. SDKI data for 2023 shows a stunting prevalence of 21.9%. The risk factors for stunting are very complex, healthy maternal behavior in interacting with toddlers is one of the factors that needs to be considered. The purpose of this study was to analyze healthy maternal behavior in households with stunting incidents in the Kawalu sub-district of Tasikmalaya City. Healthy behaviors in this study include early breastfeeding initiation practices, exclusive breastfeeding practices,routine toddler weighing practices to integrated health posts, hand washing with soap (CTPS) practices, and toddler feeding practices. The research method used was case-control with 170 respondents (85 cases and 85 controls). The data collection process was conducted through interviews with toddler mothers using questionnaires. The collected data were analyzed using the Chi Square statistical test at an alpha significance level of 0.05. The results showed a significant relationship (p <0.05) between the variables of Early Breastfeeding Initiation (IMD), exclusive breastfeeding practices, routine toddler weighing practices, mother hand washing practices with soap (CTPS), toddler feeding practices with the incidence of stunting in toddlers. Suggestions for toddler mothers to improve healthy behavior at home to prevent stunting in toddlers.

Overview of Dengue Hemorrhagic Fever (DHF) and Environmental Factors in Banjarnegera Regency

Widya Hary Cahyati, Salsabilla Putri Maharani — Thu, 02 Jan 2025 00:00:00 +0700

Dengue Fever (DBD) is a contagious disease caused by the dengue virus and is transmitted through the bites of mosquitoes from the Aedes genus, specifically Aedes aegypti and Aedes albopictus. There are three factors that can influence the occurrence of dengue fever: the agent, host, and environment. The agent of dengue fever is the dengue virus, the host is humans, and the environment consists of biotic and abiotic factors. According to data from the WHO, in 2015, there were 96 million cases of dengue fever reported from 128 tropical countries. In Banjarnegara Regency, in 2022, the number of dengue fever cases reached 479, an increase from the previous year, 2021, which had only 175 cases. The breeding of the dengue disease vector is closely related to climate change, suggesting that climate change can increase the risk of dengue transmission due to the rising population of dengue-carrying mosquitoes. This study aims to examine the description and pattern of relationships between independent variables, namely rainfall, wind speed, humidity, temperature, and sunshine duration, and the dependent variable, which is the incidence of dengue fever. This research will be conducted using a descriptive observational design. The study will observe the independent variables to illustrate the correlation trends between the independent and dependent variables through ecological studies. The results indicate a positive correlation trend between dengue fever incidence and rainfall, as well as a negative correlation trend between dengue fever incidence and sunshine duration. Meanwhile, the variables of wind speed, humidity, and temperature did not show any correlation with the incidence of dengue fever in Banjarnegara from 2018 to 2022. In conclusion, the variables that showed a correlation with the incidence of dengue fever in Banjarnegara were rainfall and sunshine duration.

History of birth weight and birth length as predictors of stunting in toddlers

Mimi Ruspita, Siti Harnina Bintari, RR Sri Ratna Rahayu, Eko Farida — Thu, 02 Jan 2025 00:00:00 +0700

Indonesia is still faced with nutritional problems in children under two years old. One of the nutritional problems currently is stunting. Children with a history of low birth weight and low birth length are potential factors influencing the incidence of stunting. This study aims to examine the risk of birth weight and birth length history with the incidence of stunting in toddlers. The research design used cross sectional with secondary data sources from nutritional status reports at the Community Health Center. The research sample consisted of 256 children under two years old from 3 Community Health Centers in Kendal Regency, Indonesia, which were divided into case groups and control groups, using cluster sampling techniques for regional samples and random sampling techniques for respondent samples. Bivariate data analysis used the chi-square test and multivariate data used the logistic regression test. The results of bivariate analysis show that there is a significant relationship between history of birth weight (p value = 0.000) and birth length (p value = 0.004) with the incidence of stunting in toddlers. Based on the results of multivariate analysis, it was found that a history of low birth weight was the most dominant risk factor associated with the incidence of stunting. The results of this research can be applied as a preventive measure, because history of birth weight and birth length can be use as stunting predictors in toddler’s growth and development period.

The Influence Of E-Booklet Media On Obesity Management On Knowledge And Attitudes In Obesite Teenagers

Yuldan Faturahman, Tahani Nisrina Nadhifah — Thu, 02 Jan 2025 00:00:00 +0700

There are three burdens of nutritional problems currently being faced, namely stunting, wasting, and obesity. In 2023, Tasikmalaya Regency recorded 671 cases of obesity in children and adolescents in health screening. The findings of obesity cases were dominated by adolescents at the SMA/MA/SMK levels of 225 cases, Leuwisari District was the area with the highest case findings in Tasikmalaya Regency. The two schools with the highest total case findings amounted to 42 cases. The purpose of this study was to analyze the effect of e-booklet media on obesity management on the knowledge and attitudes of obese adolescents at Singaparna Vocational School and Daaruddawah Vocational School. The research method used was the quantitative Preexperimental method with a one group pretest posttest design with a hypothesis test using the Wilcoxon test on the knowledge variable and the paired samples t-test on the attitude variable. The sample in this study was 42 obese adolescents. The sampling technique used in the study was total sampling. The results of the study found that there was an increase in knowledge (6.21 points) and attitudes (1.91 points) about obesity management in obese adolescents, so it can be concluded that there is an influence of e-booklet media about obesity management on knowledge (p = 0.000) and attitudes (p = 0.011) of obese adolescents. The suggestion of this study is that the e-booklet that has been designed can be used as a health promotion media material about obesity management.

Osteoarthritis Screening Based on Womac Index in Diabetes Mellitus Patients Aged ≤ 45 Years

Nur Lina, Siti Novianti, Yuldan Faturahman, Nur Hidayanti — Thu, 02 Jan 2025 00:00:00 +0700

Osteoarthritis (OA) is a chronic and systemic disease and involves joint damage including degradation of hyaline articular cartilage, ligaments, menisci in the knee. Diabetes Mellitus (DM) causes various changes in bone structure, which will increase the risk of OA. The purpose of this study was to conduct OA Screening in DM patients and provide information on OA risk factors in DM patients, especially aimed at preventing OA and DM, preventing further complications, and improving the quality of life of DM patients with OA. This study used a Cross-sectional design. The study population was DM patients aged ≤ 45 years who were recorded at the Kedungreja Health Center totaling 86 people and the Cipari Health Center totaling 67 people who were limited to the age of ≤ 45 years. The sample of this study was the entire population of 153 patients. The WOMAC Index was used to conduct OA screening in DM patients. The average pain score based on the WOMAC Index was 7.23. The average stiffness score based on the Womac Index was 3.65, and the average physical function impairment was 17.5 with an average total score based on the Womac index of 28.03. The results of the Spearman Rank Correlation Statistical Test showed that Age, BMI were related to the Pain Degree Score in DM patients aged ≥ 45 years. Dietary modification to prevent obesity, and intensive glycemic control should be performed and encouraged to delay the onset and severity of pain in OA.

Uncovering Key Factors in Healthcare Utilization among Myanmar Migrant Workers in Chiang Rai, Thailand

Thu, 02 Jan 2025 00:00:00 +0700

Since 2021, there has been a significant surge in Myanmar nationals entering Thailand as migrant workers, necessitating urgent research on their healthcare utilization, which is closely linked to disease occurrence. This study aimed to identify key factors influencing healthcare utilization among Myanmar migrant workers in Mueang District, Chiang Rai province, Thailand. A cross-sectional study was conducted with 355 Myanmar migrant workers, aged 18 to 60, in Mueang District. Data were collected through face-to-face interviews using a validated questionnaire. Descriptive analysis and inferential analysis, including Chi-square and Fisher’s Exact tests were performed. Of the 355 participants, 55.8% were male, and 44.2% were female, with a mean age of 35 years (SD ±9.46). A significant proportion (70.7%) had health insurance, and 96.3% had documented legal status. Regarding healthcare utilization, 49.6% of participants accessed healthcare services for illnesses in the past six months. Healthcare utilization was associated with factors such as the person assisting in seeking care, monthly income, monthly expenses, health insurance coverage, and daily working hours, all showing statistically significant relationships (p-value ≤ 0.05). This study identified key factors influencing healthcare utilization among Myanmar migrant workers in Chiang Rai. The findings provide valuable insights for healthcare professionals and policymakers, enabling them to design more effective interventions and tailored programs that promote healthcare inclusivity and equity for this marginalized population. A mandatory contribution to the Social Security Scheme by both employers and employees should be implemented to ensure broader healthcare coverage.

Efforts to Prevent Anemia in Adolescent Girls through Education: A Sistematic Literature Review

Kadek Primadewi, Ni Komang Intan Prima Asri — Thu, 02 Jan 2025 00:00:00 +0700

Iron deficiency anemia is one of the leading causes of morbidity and disability in adolescents. The prevalence of anemia among adolescent girls in Indonesia was 37.1%, which increased to 48.9% in 2018, with the proportion of anemia in the age group of 15-24 years and 25-34 years. Low knowledge of anemia and nutrition in adolescents will cause them to not care about daily food intake. To estimate efforts to prevent anemia in adolescent girls through education that can be used as an intervention. This study used a literature review using the Prisma method (2020), searching journals through Scopus and Pubmed, using keywords, and obtaining 7 major international journals, which were reviewed and analyzed by researchers. Efforts to prevent adolescent anemia can improve knowledge and attitudes and influence adolescent behavior. School-based interventions through health education about the causes of iron deficiency anemia are very important to reduce the number of people with iron deficiency anemia in adolescents. There is an influence on the level of knowledge of adolescent girls after being given education, but prevention efforts need monitoring and support from related parties such as family, peers, schools, communities, and governments so that the program's success can be adequately achieved. This literature study can be used as reference material for future researchers to examine anemia-related studies using other concepts and methods.

The Importance of Centralized Ethics Committee for Universities

Thu, 02 Jan 2025 00:00:00 +0700

The research ethics committee plays a crucial role in ensuring that all processes within the research stages are carried out according to procedures and do not violate ethical standards. Additionally, it ensures that human rights, security, safety, and well-being as subjects are well protected when involved in a research process. However, the current reality shows that University A does not yet have an institutional research ethics committee composed of medical and non-medical professionals at the university level. A centralized ethics committee at the university level is highly needed to be more easily developed and monitored institutionally. Moreover, it has the potential to receive more optimal resource allocation, ensure more comprehensive quality control of the ethical review process and procedure implementation, provide broader access for all units to obtain services, and enable more accountable and institutionalized income-generating management. This study aims to conduct an initial needs assessment to develop a centralized ethics committee institution at the university level. This type of research is qualitative, using purposive sampling, and the data are analyzed qualitatively and descriptively. The results show that of the 17 universities surveyed, 11 universities (65%) have ethics commissions at the faculty level, 5 universities (29%) at the university level, and 1 university (6%) is positioned under the Directorate of Research. All of the ethics commissions have similar rates and procedures. The study indicates that, for the development of the research ethics committee institution, there is at least a need for competent and trained ethics committee members, official appointment letters for the ethics committee members, a decree for the establishment of the institution, a secretariat office, service procedures, service information system, service rates, and administrative staffs.

Determinants of the Regularity of Cervical Cancer Screening among Women in Semarang, Indonesia

Fitri Indrawati, Wahyuti Risma Dhani — Thu, 02 Jan 2025 00:00:00 +0700

Based on data from the 2021 Indonesian Health Profile, cervical cancer ranks second after breast cancer, accounting for 36,633 cases or 17.2% of all cancers in women. In 2023, the cervical cancer screening coverage in Indonesia is projected to reach only 7.02% of the target of 70%. Method: This research follows an observational analytic design with a cross-sectional approach. The data was obtained from secondary data from the 2023 Indonesian Health Survey. Results: The bivariate analysis using the Chi-square test indicated a statistically significant relationship between employment status, age, economic status, education level, and the regularity of cervical cancer screening (p-value <0.001). Conclusion: It is evident that there is a relationship between employment status, age, economic status, and education level with the regularity of cervical cancer screening. Continuous health promotion activities focusing on cervical cancer screening are essential to enhance the regularity of cervical cancer screening.

Successful Happy Aging: A Literature Mapping with Bibliometric Analysis Using VoS Viewer

Herni Sulastien, Bambang Budi Raharjo — Thu, 02 Jan 2025 00:00:00 +0700

Happiness is a central goal for the elderly, with a strong focus on achieving a high quality of life as they age. In this demographic, happiness is often shaped by a lifetime of experiences. This study aims to expand the "Happy Aging" literature by analyzing recent academic publications. A total of 567 articles published between 2021 and 2024 were reviewed and sourced from Google Scholar (200 articles), PubMed (101 articles), Scopus (6 articles), and Dimensions (260 articles). The keywords used in the search were "elderly OR aging" and "happy AND policy," with articles restricted to those published between 2019 and 2024. A bibliometric analysis approach was employed, examining sources, authors, and keyword relevance, with visualizations created using VOS Viewer software. The findings reveal that various factors, including perceptions, geographic location, access to information, mental health, support systems, country, services, group dynamics, and emotional well-being, influence success in achieving happiness in old age. Understanding these factors, particularly from the perspective of the elderly, is crucial for preparing society with an aging population. Future research faces the challenge of identifying ways to provide effective support through family, social, and religious systems, empower the elderly, and address issues related to mental health, living conditions, and overall health.

Systematic Review: Diabetes Mellitus Risk Prevention Program in Indonesia

Umi Malikhatul Basiroh — Thu, 02 Jan 2025 00:00:00 +0700

One of the health problems of Non-Communicable Diseases (NCDs) is Diabetes Mellitus. According to WHO, there are still 382 million people suffering from the disease. Diabetes Mellitus in the world on 2019. Diabetes Mellitus can be prevented by controlling its risk factors. The purpose of writing this article is to find out the Diabetes Mellitus risk prevention program in Indonesia. The method used in writing this article is a literature review study with a systematic review method. The articles reviewed were obtained through a search on Google Scholar in the period 2020-2024 with the search keywords being Prevention Program, Diabetes Mellitus Risk. Using PRISMA, 6 journal articles were obtained which will be reviewed. The results of the study indicate that Diabetes mellitus can be prevented by diet management (eating patterns), lifestyle changes, physical activity, education and family support. Therefore, the diabetes mellitus prevention program with a diet management approach (eating patterns), lifestyle changes, physical activity, education and family support can continue to be improved, so that family and community awareness is much better in preventing non-communicable diseases Diabetes Mellitus.

Socio-Cultural Perspectives of Early Marriage between Teenagers and Parents in Rural Communities

Muhammad Azinar, Zahroh Shaluhiyah, Sutopo Patria Jati, Cahya Tri Purnami — Thu, 02 Jan 2025 00:00:00 +0700

Early marriage (under 19 years) has a very serious impact on both the mother and the child born. Grobogan Regency is an area in Central Java province, most of which is rural. The prevalence of women marrying and getting pregnant at an early age in this area is very high, reaching 59.88% in 2018, 51.24% in 2019 and 52.81% in 2020. This figure is much higher than the figure for Central Java province, which is 37.67%. Teenagers are the main actors in early marriage, especially in rural communities.. This type of research is survey research with a cross-sectional design.The population is junior high school students aged 13-16 years in Grobogan sub-district as an area with the highest incidence of teenage marriage in Grobogan Regency, Central Java. The minimum sample size is calculated according to the Slovin formula with a 95% confidence level, obtaining a total of 185 students and their parents.Data were collected using a questionnaire. Univariate and bivariate analysis using the testMann Whitney. The results of the study stated that the perceptions of teenagers and their parents were also not much different. Significant differences were only related to the perception of matchmaking by parents as the cause of teenage marriage and the perception of the lack of reproductive health information and the impact of early marriage can encourage early marriage.

Determinants of Minors Motorcycle Riders

Thu, 02 Jan 2025 00:00:00 +0700

Underage riders have a higher risk of injury compared to older riders. In January 2024, there were 11,565 road accidents nationwide, with 4,464 accidents (32.4%) involving teenage riders. In Semarang City, there were 1,339 road accidents in 2023. The decision of underage children to ride a motorcycle was influenced by various factors. The aim of this study was to determine the variables associated with underage motorcycle use. This study was an analytical observational study with a cross-sectional approach. The sample of this study consisted of 447 respondents. The data were collected using an online questionnaire, which was then analyzed using the Chi-square test. The results showed that the variables of gender (p=0.001), parental permission (p=0.000), parental monitoring (0.000), peers influence (0.000) and motorcycle facilities (p=0.000) had a statistical relationship with underage motorcycle use. On the other hand, the variable parental education (p=0.396) has no significant relationship with underage motorcycle use. Peers are the factor that most influences the underage to use motorcycles.

Design and Validation of Instrument for the Development of Information System Model for Personal Health Record Management of Elementary School Students

Asharul Fahyudi, Joko Sutarto, Joko Widodo, Edy Purwanto — Thu, 02 Jan 2025 00:00:00 +0700

The information system for managing personal health records of elementary school students has an important role in maintaining children's health. Recording health data, such as health screening activities in elementary schools, is important to see children's growth and development. The purpose of this research is to design and validate the research instruments needed for the development of the Student Personal Health Record Management Information System (SIM-RKPS). The quantitative descriptive research method, using a questionnaire of 14 items distributed to 36 respondents. The results of the validity test show that most of the items in the research instrument have a high Corrected Item-Total Correlation value, meaning that each item is strongly correlated with the total scale. This significant correlation value reflects that the items are able to measure the same construct well. Items such as the SOP for Data Management and Special Budget have a correlation value of 0.912 which means that these items are very valid. Most items have a correlation value > 0.7 which is a generally accepted threshold for good validity. However, there are some items, such as Sick Student Handling, which has a lower correlation value of 0.582 indicating that this item has a weaker relationship with the constructed being measured. The reliability test showed a Cronbach's Alpha value of 0.972, indicating that this instrument is reliable.

Determinants of Prospective Aceptors Selection of Long-Acting Reversible Contraceptive (LARC) at Puskesmas Korpri, Kubu Raya District Year 2022

Elise Putri — Thu, 02 Jan 2025 00:00:00 +0700

The Covid-19 pandemic had an impact on all programs, including the Family Planning program. Under these conditions and when there are short-term upheavals such as natural disasters, contraception users, especially short-term contraceptive method acceptor will be vulnerable to sustainability. The aim of the study was to analyze the Dominant Determinant Factors for Family Planning Prospectives Acceptor Associated with the Selection of Long- Action Reversible Contraceptive (LARC) Method During the Pandemic Period at the Puskesmas Korpri, Kubu Raya Regency, in 2022. This study uses a correlation analytic design with a cross-sectional approach. The sample in this study amounted to 299 people selected using a purposive sampling technique. This research was conducted in November-December 2022 and has gone through the stages of data collection, data processing and data analysis used,that is univariate analysis, bivariate analysis and multivariate analysis. The variables age, parity, knowledge, husband's support have no relationship with the election of LARC, while the variables of family income and support from community leaders have a relationship with the election of LARC. The variables that most dominantly influence acceptors in choosing LARC are family income variables with a p value of 0.033 and odd ratio (OR) of 0.112 (0.015-0.837), while the age variable and the variable support from community leaders are confounding variables. Prospective acceptors and spouses can increase knowledge about LARC which will be used through access to information that is easy to obtain during the pandemic that is made or managed by the health centre, as well as from leaflets and banners about LARC Methods. Midwives, family planning extension workers and family planning cadres as well as community leaders can carry out coordination in each village and can provide Information Communication and Education (IEC) to the community.

EXCLUSIVE BREASTFEEDING BEHAVIOR

Andri Tri Kusumaningrum, Widya Hary Cahyani, Bambang Budi Raharjo — Thu, 02 Jan 2025 00:00:00 +0700

According to WHO, exclusive breastfeeding is the best method for feeding infants from birth to 6 months of age without additional food. This practice is influenced by various factors, including maternal age, occupation, maternal knowledge, family support, health worker support, and the Early Initiation of Breastfeeding (IMD) process. This study aims to analyze the influence of these factors on exclusive breastfeeding in infants. Objective Methods: The method used is a quantitative analytical observational study with a cross-sectional approach, conducted in the Lamongan health center area. The sample consisted of breastfeeding mothers who had infants aged 6-12 months with a total sampling technique. The variables of this study include independent variables: maternal age, occupation, knowledge, family support, health worker support, and the IMD process, and the dependent variable: exclusive breastfeeding. The instrument used was a questionnaire, with data analysis using the chi-square test and multivariate test using logistic regression. Results: The results of the study involved 71 samples of breastfeeding mothers; the majority of respondents (78.9%) who provided exclusive breastfeeding were 25-35 years old, had good knowledge, and were unemployed. All respondents received support from family and health workers, and most (85.9%) experienced the IMD process. The results of the bivariate test showed no relationship between age (p = 0.163), occupation (p = 0.592), and knowledge (p = 0.452) with exclusive breastfeeding, but there was a relationship between the IMD process (p = 0.010) and exclusive breastfeeding. The multivariate test showed that the most influential factor on exclusive breastfeeding was the IMD factor. Conclusion: In conclusion, although there was no relationship between age, occupation, and maternal knowledge with exclusive breastfeeding, the IMD process was significantly related, becoming the dominant factor influencing exclusive breastfeeding in infants.

Systematic Review: Factors Affecting Treatment Adherence of Elderly Hypertension Patients

Ani Nur Fauziah, Anggie Pradana Putri, Bambang Budi Raharjo — Thu, 02 Jan 2025 00:00:00 +0700

Hypertension remains a significant public health problem, contributing to the onset of cardiovascular disease, stroke, and premature death. Medication adherence is a real support for the treatment success. However, it is often neglected in older people and will have a negative impact on their condition.This study aims to identify what factors are associated with treatment compliance of elderly hypertensive patients based on empirical studies in the last five years. This type of research uses a systematic review method and reference sources derived from research journals sourced from three databases namely Google Scholar, PubMed and ResearchGate from 2019 to 2024. Of the 331 journals identified, 16 journals were included in the synthesis data. The convergent integrated analysis framework suggested by Joanna Briggs Institute (JBI) for systematic reviews was adopted for the data synthesis of the included studies Adherence to hypertension treatment in the elderly is influenced by multi-factors with different variations between settings and individual characteristics. Several factors were identified, namely modifiable factors ((1) social and economic related factors: Education, income, occupation, (2) factors related to health workers and systems: support from health workers, (3) factors related to patient therapy: duration of treatment, number of drugs and motivation for treatment, (4) factors related to patient's disease: depressive symptoms and weight management, (5) patient-related factors: family support, health insurance, living environment, attitude, knowledge, intention, benefits, (6) factors related to disease management: counseling and community-based health programs and non-modifiable factors (factors related to patient's disease: duration of suffering, comorbidities and history of stroke, and patient-related factors: age).This research is limited to the study of correlation studies (majority cross-sectional) so in the future more comprehensive research is needed to be related to the analysis of factors related to hypertension treatment compliance. Qualitative study designs can be added (mixed-method) to produce more in-depth analysis results.

THE EFFECT OF GROUP GUIDANCE WITH THE MIND MAPPING METHOD ON INCREASING THE KNOWLEDGE OF FERTILE AGE COUPLES IN EFFORTS TO PREVENT STUNTING

Anita Dyah Listyarini, Oktia Woro Kasmini Handayani, Eko Farida — Thu, 02 Jan 2025 00:00:00 +0700

Stunting is a chronic nutritional problem that is a public health challenge in Indonesia, especially in children under five years of age. Stunting prevention needs to be started early, especially in fertile couples, who have an important role in preparing the health conditions of mothers and children. This study aims to analyze the effect of group guidance with the mind mapping method on increasing the knowledge of fertile couples in preventing stunting. The research method used was a quasi-experiment with one group pretest-posttest design using a control group. The subjects of the study consisted of 34 fertile couples selected by purposive sampling. The intervention group was given group guidance using the mind mapping method, while the control group was given conventional guidance. Knowledge measurements were carried out before and after the intervention using a structured questionnaire. Data analysis used the Wilcoxon test. The results showed that there was a significant increase in the knowledge of fertile couples regarding stunting prevention in the intervention group compared to the control group. A better understanding of the importance of nutritional intake, health care during pregnancy, and newborn health management indicates this increase in knowledge. Group guidance with the mind mapping method has proven effective in helping participants organize information visually and improve their memory. Thus, this method can be recommended as an innovative educational approach in efforts to prevent stunting.

Unintended Pregnancy in Pekalongan: A Qualitative Study

Thu, 02 Jan 2025 00:00:00 +0700

According to data from the Good Mention Institute, as cited in the Stability Report 2022, the issue of unintended pregnancies in Indonesia rose by 40 percent, approaching the global figure of 60 percent (Kompas, 2022). Data from the World Health Organization (WHO) indicate that out of 200 million pregnancies per year, 75 million, or 30%, are unintended, with 95% of these unintended pregnancies occurring among adolescents.Methods.This research employs a phenomenological design with a qualitative approach, involving 10 informants who consist of 2 main informants, 4 supporting informants, and 4 triangulation informants, selected using purposive sampling techniques. Data collection was conducted through in-depth interviews with the informants.Results.Based on data from the Pekalongan District Health Office, the highest increase in cases of unintended pregnancy was reported at the Wonokerto I Community Health Center. From 2021 to 2022, there was an increase of 12 cases of unintended pregnancy at this center. Research findings indicate that a significant portion of these cases stems from parents who employ ineffective and lenient parenting styles.Additionally, the study revealed that the phenomenon of unintended pregnancy within the community surrounding the health center reflects significant weaknesses in communication between parents and children. The communication that occurs between parents and children is not intensive, leading to a lack of assertive control by parents, which is primarily limited to occasional reprimands when rules are violated. This reflects ineffectiveness in supervision and discipline, as evidenced by children's habitual lying to their parents and frequent rule violations, such as returning home later than the agreed-upon time. Conclusion :The phenomenon of unintended pregnancy is influenced by weaknesses in communication and discipline among parents, which increase the risk of risky behavior in children. Furthermore, a lack of knowledge and consistency in parenting styles contributes to the rising cases of unintended pregnancy.

Trend of Stunting Cases related to Increased Access to Sanitation and Antenatal Care Visits: Correlation Study in Lampung, Indonesia

Arfan Syahroni, Irwan Budiono, Siti Harnina Bintari, Eko Farida — Thu, 02 Jan 2025 00:00:00 +0700

: Significant progress has been made globally in reducing chronic malnutrition and stunted linear growth among children under the age of 5, though rates remain high in many regions. Policies, programs, and interventions supporting maternal and child health and nutrition hold potential to enhance child growth and development. Although cases have declined in Indonesia over the past decade, the trend in Lampung Province remains unclear. This article aims to illustrate the trend of stunting cases in Lampung Province and determine whether this trend correlates with increased access to Antenatal Care (ANC) and improved sanitation. We collected data from the Basic Health Research (Riskesdas) surveys conducted between 2007 and 2022. The data were then analyzed, and a correlation test was conducted to assess the relationship between the stunting trend, ANC visits, and sanitation improvements. Stunting cases across each district showed a decline; however, between 2007 and 2013, there was an increase in three districts: Central Lampung, Bandar Lampung City, and Metro City. Another increase was observed in Way Kanan district between 2013 and 2018. Nevertheless, each district managed to achieve a significant reduction in cases by 2022. The correlation test results indicate that the reduction in stunting cases in Lampung Province is associated with increased ANC visits and improved sanitation access. Enhancing the coverage of ANC services and improving sanitation conditions are closely associated with a decrease in stunting prevalence. ANC access has a stronger correlation with the reduction in stunting rates than sanitation, though both are significant factors influencing stunting prevalence.

The Effect of Early Breastfeeding Initiation on the Length of the Third Stage of Labor

Ari Andayani, Heni Hirawati Pranoto, Ari Yuniastuti — Thu, 02 Jan 2025 00:00:00 +0700

Postpartum hemorrhage is the second leading cause of maternal death in Indonesia. In 2022, the bleeding rate in Central Java was 22.5%. The government's efforts to prevent postpartum hemorrhage are active management of the third stage (giving oxytocin 10 IU immediately after the baby is born IM), but until now postpartum hemorrhage still contributes to maternal mortality. Natural efforts made to prevent bleeding are Early Initiation of Breastfeeding (IMD). Early initiation of breastfeeding is the process of giving newborns the opportunity to find their own nipples by placing the baby on the mother's chest to start breastfeeding during the first hour of giving birth. The IMD process can stimulate the back of the pituitary gland to produce natural oxytocin which can stimulate uterine muscle contractions. The purpose of the study was to determine the effect of Early Initiation of Breastfeeding on the Length of the Third Stage in mothers in labor. This research method uses a Quasy experimental with a Post-test Only Control Group Design, the study population is all mothers who gave birth in February - April 2023 at Ibu Alam Salatiga with an accidental sampling technique, the data used in this study is primary data, namely data obtained from direct observation respondents. Research analysis using the Mann Whitney test. The results of the study showed that there was a significant effect of early breastfeeding initiation on the length of the third stage in mothers giving birth with a p value of 0.001 (p value <0.05). Conclusion There is an effect of early breastfeeding initiation on the length of the third stage.

Electronic Medical Records Vs Manual Medical Records: A Qualitative Study on Specialist Doctors in a Rural Hospital

Faza Khilwan Amna — Thu, 02 Jan 2025 00:00:00 +0700

The use of electronic medical records (RME) in hospitals continues to increase along with the need to improve efficiency and accuracy in patient data management. However, the transition from manual medical records to RME faces significant challenges, especially in technology adaptation in resource-constrained environments. The main issue faced in this study was to compare the effectiveness, safety, and management support between RME and manual medical records from a specialist's perspective. This study aimed to identify the advantages and disadvantages of using RME compared to manual medical records, as well as evaluating specialists' experiences in using both systems. This study used a qualitative approach through questionnaires and in-depth interviews with 12 specialists in a rural hospital, conducted at RS Muhammadiyah Mardhatillah Randudongkal, Pemalang District, in September 2024. Data were analyzed to understand perceptions, preferences, and challenges in using RME and manual systems. Eight out of 12 doctors (67%) preferred RME due to its ease of access and efficiency. Six doctors (50%) stated that RME reduces recording errors and helps collaboration between medical professionals. However, 4 doctors (33%) doubted data security and 5 doctors (42%) reported technical glitches. In contrast, manual systems were rated as more reliable in emergency situations (8%), and 2 doctors (17%) felt safer from the risk of hacking. A total of 67% of doctors rated RME training as adequate, but technical support needs to be improved. Although RME offers many advantages, technical barriers and security-related concerns remain a challenge. Continued support and further training are needed to ensure the successful adoption of RME in rural hospitals.

Progressive Muscle Relaxation Training on Reducing Anxiety in Chronic Disease Patients in the Elderly

Noviana Ayu Ardika, Mulyaningsih Mulyaningsih — Thu, 02 Jan 2025 00:00:00 +0700

Hypertension is a condition experienced by a person with an increase in blood pressure above normal consistently where the systolic pressure is above 140 mmHg and the diastolic pressure is above 90 mmHg. One of the anxiety management methods is by psychotherapy. One of the anxiety management methods with psychotherapy methods is by conducting progressive muscle relaxation therapy. Progressive Muscle Relaxation is a relaxation technique to get a feeling of relaxation, so that it can reduce anxiety and stress. The purpose of the study was to determine the application of Progressive Muscle Relaxation therapy to reduce anxiety in people with hypertension. This study used the quasi-experimental deshain method (quasi-experimental design), with the design used being the one group pretest and post test design. This design does not use a comparison group (control), but uses the first observation (pretest) which allows testing the changes that occur after treatment or post test. The number of respondents was 26, obtained a p value of 0.000 (p <0.05). So it can be concluded that there is a difference in the average value of the pre-test & post-test anxiety levels, so that there is an effect of progressive muscle relaxation therapy on the anxiety of the elderly with chronic diseases at the Melati integrated health service post.

Availability of Health Personnel in Achievements of Community Health Center Performance Indicators in Lamongan District in 2022

M. Bakri Priyodwi Atmadji, Widya Hary Cahyati — Thu, 02 Jan 2025 00:00:00 +0700

Minimum Service Standards (MSS) in the health sector are provisions regarding the type and quality of basic services that every citizen can obtain at a minimum. Regional governments need to carry out performance assessments based on MMS indicator achievements to monitor institutions' performance. The performance assessment results can then be used for training and evaluation in the health development efforts carried out. This study aimed to identification availability of health personnel in achievement of community health center performance indicators in 2022. Secondary data was obtained from the Lamongan Regency Health Profile in 2022. Data on the number and type of health workers in community health centers and MMS achievements in the health sector were subjected to statistical tests using Chi-Square. Results: Chi-Square test of the relationship between the type of health workers in the community health center and the MMS performance achievement indicators in the health sector (p = 0.009), and the relationship between the number of health workers based on the minimum standards for community health workers in the health center and the achievement of the MMS performance indicators in the health sector (p = 0.002). There is a significant relationship between the number and type of health workers at the community health center and performance indicators for the Minimum Service Standards for the Health Sector at the Lamongan Regency community health center.

Lavender Aromatherapy on Pain Intensity in the First Stage of Giving Birth Women at South Tangerang City Hospital

Catur Erty Suksesty, Titis Wahyuni, Lia Nurcahyawati — Thu, 02 Jan 2025 00:00:00 +0700

The number of deliveries in health care facilities in 2021 in Indonesia was 90.9%. Delivery pain is an unavoidable experience and is one of the main determinants in the delivery process. Inappropriate management of this pain can cause negative physiological and psychological impacts. This study aimed to determine the effect of aromatherapy on the intensity of pain in mothers giving birth in the Active Phase 1 at the South Tangerang City Hospital in 2023. The research method used in this study was quantitative, with the research design used being Quasi Experiment with a Pre-test Post-test One Group Design research design. The population in this study were all mothers giving birth from January to March at the South Tangerang City Hospital, totaling 108 people. The sampling technique was carried out using purposive sampling, obtaining 52 respondents. The analysis in this study used a paired T-test to determine the effect of lavender aromatherapy on the intensity of delivery pain in the active phase I. The results of the study showed that the pain scale before giving lavender aromatherapy to mothers in the first active phase of delivery was mostly in the severe pain category of 21 people (40.4%) and a small portion of moderate pain of 15 people (28.8%). It was found that the pain scale after giving lavender aromatherapy was mostly in the moderate pain category of 32 people (61.5%) and a small portion of severe pain of 16 people (30.8%). Based on the results of statistical tests using the T-test (Paired Samples Test), the P value (0.000) was obtained which was smaller than the α value (0.05), so it can be concluded that there is an effect of giving lavender aromatherapy on delivery pain. It is hoped that the results of this study can motivate health workers to manage delivery pain by utilizing aromatherapy.

Effectiveness of Point ST36 (Zusanli) Acupressure on Emesis Gravidarum First Trimester in the Tengaran Health Center

Ninik Christiani, Ilmi Nur Wulan Bitara — Thu, 02 Jan 2025 00:00:00 +0700

Emesis gravidarum or nausea and vomiting are complaints that are often experienced by pregnant women in the first trimester, but if not handled appropriately, it will cause health problems for pregnant women, which not only disturb the mother but also the fetus she is carrying. Based on a preliminary study conducted in August 2023 at the Tengaran Health Center in Semarang Regency, data was obtained that the total number of pregnant women in the last month (July 2023) was 177 people and 35 people were included in the first trimester category. The results of observation of 35 pregnant women in the first trimester obtained data that 22 people (62.86%) experienced emesis gravidarum and 13 (37%) did not experience emesis gravidarum. There are many things that affect the occurrence of emesis gravidarum, including age during pregnancy, parity, work and gestational age. One of the treatments that can be done is by providing non-pharmacological therapy, ST36 point acupressure (Zusanli) which has no side effects. The goal is to find out whether there is an effect of ST36 point acupressure on emesis gravidarum in the first trimester in the Tengaran Health Center in 2023. The design of this study is Quasy-Experiment with One Group Pre-Test Post-Test. The number of samples used was 20 respondents in December 2023 at the Tengaran Health Center using the Total Sampling technique and using the PUQE-24 instrument. The data analysis used was Univariate and Bivariate data analysis, using a non-parametric statistical test, namely the Wilcoxon Test. The results of the Wilcoxon test obtained a sig value of 0.000, which means a p value of < α (0.05), then Ha was accepted and Ho was rejected, which means that there is an effect of ST36 (Zusanli) acupressure on the first trimester emesis in the Working Area of the Landmark Health Center. There is an effect of acupressure massage point ST36 (Zusanli) on emesis gravidarum in the first trimester in the Working Area of the Tengaran Health Center.

Risk Factors and Impact of High-Risk Pregnancy on Neonatal Outcomes in Lamongan

Diah Eko Martini, Mahalul Azam, Widya Hary Cahyati, Yuni Wijayanti — Thu, 02 Jan 2025 00:00:00 +0700

High-risk pregnancy is a problem which received great attention in the current era, considering that the pregnancy poses a great risk of increasing morbidity and perinatal mortality both in pregnant women, the delivery process, and even newborns. Therefore, prevention efforts with early detection of risk factors need to be performed to reduce maternal and infant mortality. Likewise, data related to risk factors and their impact required to be conveyed to perceive the magnitude of the problem so that prevention and treatment efforts can be maximized. The purpose of this study was to present objective data related to sociodemographic and its relation to the impact of high-risk pregnancy. The research design applied correlational analytics with a population taken from the medical record data of pregnant women who at the time of entering the ward had high risk pregnancy indicators based on the Poedji Rochjati score above 6. The research sample was obtained by total sampling with a total sample size of 91 high-risk pregnant women. The data was then analyzed using a cross table and Spearman’s rank test. The results showed that maternal age, medical history, and obstetric factors had a significant relationship with high-risk pregnancies (p=0.026; 0.004, rs; 0.229; 0.302), in which very high-risk pregnancy had a higher proportion in mothers over 35 years of age, and obstetric emergency namely bleeding and PEB also had a greater risk of very high-risk pregnancy than high-risk pregnancy while the weight and length of the baby and gestational age, had no statistical effect in high-risk pregnancies. Thus, it can be concluded that maternal age and obstetric medical factors are risk factors for high-risk pregnancy and very high-risk pregnancy based on Poedji Rochjati’s score.

Health Screening for Premarital Women in Lamongan Regency, Indonesia: Study in 2020-2023

Dian Nurafifah, Setya Rahayu, Widya Hary Cahyati, Eko Farida — Thu, 02 Jan 2025 00:00:00 +0700

Indonesia has established a premarital health screening policy that couples who are getting married must follow to detect possible diseases that could affect the couple’s quality of life. However, not all couples participate in screening. The aim of the research is to identify the results of screening examination for premarital woman carried out by community health centers in Lamongan Regency, Indonesia from 2020 to 2023. The research design was descriptive with a population of all premarital woman who carried out health screening at the Community Health Center in Lamongan Regency. Data collection by document study. Data were analyzed descriptively using percentages. The research results showed that 81.96% of couples carried out premarital health screening, 7.41% experienced anemia, 3,73% experienced malnutrition based on BMI, and 12,83% experienced malnutrition based on upper arm circumference. The participation of premarital woman is good, this is due to the existence of a policy that requires every premarital woman to undergo premarital health screening. However, based on the screening results, it was found that there were still poor health conditions, namely that there premarital woman who were anemic and malnourished as identified by BMI and upper arm circumference. This situation can affect the quality of life of the next couple, especially the offspring produced. Efforts are needed to improve the health of premarital woman in preventing anemia and malnutrition by involving various parties, especially the family as the group closest to the premarital woman.

The Role of Autosuggestion in Hypertension Management and Quality of Life Improvement Among Elderly: A Bibliometric Analysis and Emerging Trends

Wahidin Wahidin, Heny Setyawati, Sofwan Indarjo, Dina Nur Anggraini Ningrum — Thu, 02 Jan 2025 00:00:00 +0700

Hypertension is a significant health concern, particularly among the elderly. It often results in a reduced quality of life and an increased risk of other health conditions. While pharmaceutical treatments are commonly used, non-pharmacological approaches such as autosuggestion are showing promise as alternative treatments. This study presents a thorough bibliometric analysis of research trends related to using autosuggestion to treat hypertension and enhance the quality of life for the elderly. Data was gathered from Scopus' primary academic database covering 1969 to 2024. Four thousand seven hundred relevant publications were analyzed using VOSviewer and Biblioshiny to map research networks, identify keyword emergence, and examine citation trends. The findings indicate a growing number of studies, particularly in the last five years, with significant contributions from the United States, the United Kingdom, and Germany. The thematic analysis underscores the potential of autosuggestion in managing the blood pressure of the elderly through stress management and improving emotional well-being, which contributes to better hypertension control. However, there are research gaps, particularly in the clinical application and integration of autosuggestion with conventional therapies. This study identifies emerging trends and provides insights for future research, particularly in exploring the long-term impact of autosuggestion on elderly health outcomes. These findings offer a valuable contribution to the development of non-pharmacological interventions for hypertension management and suggest promising directions for future studies.

The Effectivity of Integrated Social Media to the Patient's Understanding of Patient Safety Practice by Nurse in the Hospital

Eko Susilo, M. Imron Rosyidi — Thu, 02 Jan 2025 00:00:00 +0700

Patient safety incidents are several incidents that have the potential to threaten patient health. Efforts to meet the 6 Patient Safety Goals (PSG) standards which include; 1) accurate patient identification, 2) effective communication, 3) drug safety, 4) appropriate surgical location/procedure, 5) risk of infection, and 6) risk for falls (Albyn et al., 2022), are part of the indicators of hospital service quality . The patient's lack of understanding of the program will hinder the successful implementation of the PSG. Information related to PSG can be provided by the hospital through One solution to increase access to information is to utilize integrated social media, objectives Analyzing patients' understanding of PSG after being given Integrated Social Media (Full Text Media, Images and Text, monologue videos, and animated videos). The research used a Quesy experiment method with a design (One-group pretest -posttest design), with a simple random sampling technique of 119 patients at Dr Gondosuwarno Regional Hospital. The data analysis used was the Wilcoxon rank test. Results of patient understanding regarding (1) Patient identification by nurses p = 0.002, (2) effective communication p = 0.025, (3) drug safety p = 0.025, (4) appropriate surgical location/procedure p = 0.046, and (5) risks infection p = 0.083, (6) risk of falls p = 0.000. p-value < 0.05 (α) means there is a significant difference in. patient understanding of patient identity, effective communication, drug safety, appropriate surgical location/procedure and risk for falls. The use of Integrated Social Media has an influence on patient understanding of patient identity, effective communication, appropriate location/procedure, drug safety, and risk of falls.

Early Detection of Maternal Functioning Status on Postpartum Mother's Mental Health

Elisa Ulfiana, Tandiyo Rahayu, Yuni Wijayanti, Dina Nur Anggraini Ningrum — Thu, 02 Jan 2025 00:00:00 +0700

Postpartum mother’s mental health is a significant aspect affecting mother’s wellbeing and child’s development as well as reflecting maternal functioning status. Early detection of maternal functioning status plays significant role in identifying potential postpartum mother’s health problems. Maternal functioning is a multidimentional concept of mother’s readiness to care for baby, self care, family, and social activities. The aim of the research is to identify early detection of maternal functioning towards postpartum mother’s mental health. Research method applied was systematic literature review (SLR) with PRISMA as the guidelines. Journals with relevant topics reviewed from Pubmed, Google Scholar, and Proquest database with criteria within 10 years, published 2014-2024 using keywords Maternal Functioning Status AND Postpartum Mental Health. Inclusion criteria are English articles, randomized controlled tria design, case study, quasy experiment and full text. Analysis applied synthetisis matrix: identification, selection, eligibility, and data extraction. Review delivered 7 journals with criteria year of publication within 2017-2022, sample characteristic were postpartum mothers. Early detection of maternal functioning in postpartum mothers is an effort to improve screening on mothers to improve mother’s health and mother’s functional status. Maternal functional is the early screening to detect psychological problems during postpartum period. The instrument used for early detection of mental health is Barkin Index of Maternal Functioning (BIMF). The research finds out that maternal functioning to detect postpartum mother’s mental health using BIMF is valid and reliable.

ANALYSIS OF THE RELATIONSHIP BETWEEN DIETARY PATTERNS, NUTRITIONAL STATUS, AND MENSTRUAL CYCLE WITH THE INCIDENCE OF ANEMIA AMONG FEMALE ADOLESCENTS AT SMA STATE 3 KOTA GORONTALO SENIOR HIGH SCHOOL

Elvie Febriani Dungga, Suliyanti Otto, Alifyah Isti Inayah — Thu, 02 Jan 2025 00:00:00 +0700

Anemia is characterized by a decrease in hemoglobin (Hb), hematocrit, and red blood cell count below normal levels. The prevalence of anemia in Indonesia remains relatively high. According to the 2018 Basic Health Research (Riskesdas) data, the prevalence of anemia among adolescents is 32%, meaning 3-4 out of 10 adolescents suffer from anemia. Female adolescents are more at risk of anemia compared to males due to monthly menstruation, frequent attempts to maintain appearance, and dieting to achieve an ideal body shape, which leads to reduced food intake. Another issue among adolescents is that almost 50% skip breakfast. These factors affect hemoglobin levels in the body and trigger anemia. This study aims to analyze the relationship between dietary patterns, nutritional status, and menstrual cycle with the incidence of anemia among female adolescents at SMA Negeri 3 Kota Gorontalo Senior High School. This research was conducted using an analytical study with a cross-sectional design. The sample consisted of female adolescents at the mentioned school. The instrument employed a questionnaire. The results showed a significant relationship between dietary patterns (p-value = 0.015), nutritional status (p-value = 0.002), and menstrual cycle (p-value = 0.002) with the incidence of anemia. In conclusion, there is a relationship between dietary patterns, nutritional status, and menstrual cycle with the incidence of anemia. Female adolescents are advised to increase their intake of iron-rich foods to boost hemoglobin levels and prevent anemia. The fulfillment of essential nutrients, such as vitamin C from fruits and vegetables, also needs to be considered to support blood formation.

Sosiodemographic Factors Associated with Exclusive Breastfeeding on Working Mothers in Hospital

Thu, 02 Jan 2025 00:00:00 +0700

The rate of exclusive breastfeeding in developing countries remains low, especially among working mothers. Objective: This research aims to determine sociodemographic factors associated with exclusive breastfeeding among working mothers in Lamongan hospitals. Method: It employed a cross-sectional analytical study design with a sample of working mothers in Lamongan private hospitals who had babies aged 6 to 24 months and met the inclusion criteria of 120 individuals obtained through purposive sampling. The data were collected by a questionnaire with closed ended question and analyzed using univariate and bivariate (chi-square) methods. Results: Sociodemographic factors significantly associated with exclusive breastfeeding included education (p 0.011; OR 4.167; 95% CI: 1.176-14.765) and occupations (p 0.003; OR 3.763; 95% CI 1.513-9.357), while age, parity, and income were not significantly associated. Conclusion: Working mothers in hospitals with a diploma education have a 4.2 times higher chance of exclusive breastfeeding compared to those with a high school or equivalent education, and those working as healthcare professionals have a 3.7 times higher chance of providing exclusive breastfeeding compared to non-healthcare workers. Hospital health promotion units should intensify lactation promotion for pregnant and breastfeeding female employees, especially those at risk of not providing exclusive breastfeeding.

Examination of Acute Glomerulonephritis After Streptococcus (GNAPS) With Primer of pyrogenic exotoxin B (speB) Gene of Streptococcus pyogenes Bacteria

Fransisca Probo Setyoningrum — Thu, 02 Jan 2025 00:00:00 +0700

GNAPS is glomerular damage due to poorly managed Streptococcus pyogenes infection. The damage is dominated by toxins produced by S.pyogenes, namely streptopain or SpeB. Laboratory examination serves to diagnose S.pyogenes infection. The discovery of specific biomarkers is a priority to improve the quality of laboratory services to prevent and accelerate treatment. The design of specific primers is needed in the molecular examination of PCR method. This research used literature study from NCBI genebank to obtain SpeB gene sequence with access number L26148.1. The gene sequence was analyzed using Primer3Plus to determine candidate primers, then identified using in silico PCR amplification to determine the number of amplicons and visualization on gel electrophoresis. The results of the gene are specific to the S. pyogenes species, the homology level of the gene in the group of species tested by BLAST also shows 100%. These primers include forward primer F5' GGTGCTGACGGACGTAACTT 3' and reverse primer R3' TGCCTACAACAGCACTTTGG 5'.The primer design was able to amplify the SpeB gene region with an amplicon size of 151. These primers can be used in the examination of GNAPS by PCR method so that it is earlier to be treated so that it will reduce the mortality rate due to complications of GNAPS.

Mapping of Educational Research Publications on Anemia Prevention in Adolescent Girls: Bibliometric Analysis with Vosviewer from 2014 to 2024

Kadek Primadewi — Thu, 02 Jan 2025 00:00:00 +0700

Adolescence marks a phase of rapid growth and demands increased nutritional requirements beyond early infancy. According to the World Health Organization, about 42.3% of women aged 15-59 years and about 49% of school-aged students in developing countries suffer from iron deficiency anemia. Objective: To map anemia prevention education research trends in adolescent girls. Methods: Literature study with bibliometric analysis using VOSviewer 1.6.20 on 18 international journal articles from Scopus (2014-2024). Results: Keyword network: 10 major clusters, including anemia, adolescent girls, education, knowledge, and behavior. Recent trends: educational interventions, antihelmintic therapy, health, older age, altitude, control, amenorrhea. Keyword density: “female”, ‘adolescent’, ‘anemia’, ‘iron’, ‘folic acid’, ‘health education’, ‘adult’ were most reviewed. Potential research topics: “adolescent girl”, ‘iron therapy’, ‘attitude’, ‘girl knowledge’, ‘amenorrhoea’, ‘menstruation’, ‘food intake’, ‘health care planning’, ‘marriage’, ‘young adult’, ‘obesity’, ‘public health message’, ‘blood pressure’, ‘feeding behavior’. Conclusion: Research on anemia prevention education in adolescent girls continues to grow, focusing on education, health, and risk factor interventions. There are still opportunities for research on topics such as iron therapy, adolescent girls' knowledge, and amenorrhea.

Strengthening Stroke Recovery in Yogyakarta: The Synergistic Role of Physiotherapy, Family Support, and Educational Empowerment

Gian Lisuari Adityasiwi — Thu, 02 Jan 2025 00:00:00 +0700

Special Region of Yogyakarta is the region in Indonesia with the second highest number of stroke patients. Stroke is a disease that requires long-term rehabilitation after the patient returns home. Method: The research method used is a qualitative method. The methods used are conducting a literature review and holding focus group discussions with healthcare workers. Result: Based on discussions with nurses and doctors at community health centers (puskesmas) in Yogyakarta City, they also feel confused when asked by patients' families about how to perform movement therapy so that their stroke-affected relatives can regain their activities. The community health centers (Puskesmas) in Yogyakarta City do not have physiotherapists, who play a crucial role in the rehabilitation process of post-stroke patients. Families of patients are unable to go to the hospital for post-stroke rehabilitation due to financial constraints or difficulties with transportation and the effort required to take the patient to the hospital. Every community health center in Yogyakarta should have a physiotherapist. Additionally, families need simple care guidelines for post-stroke patients so they can assist in helping patients regain functional activities.

Age, Working Hours, Workload with Work Fatigue Among Office Workers

Heni Fa’riatul Aeni, Hamdani Amin, Muslimin Ali, Awis Hamid Dani — Thu, 02 Jan 2025 00:00:00 +0700

Work fatigue is a kind of problem related to work health and comfort which also has an impact on work productivity. Acording to the International Labour Organization (ILO), work accidents due to work fatigue lead do the death of two million workers for almost every year. This study aims to determine the correlation between age, working hours and workload with work fatigue among workers in the Office department of PT X Cirebon. The current study applied a quantitative type with a cross sectional design. The study population involved 63 office workers at PT X in 2024. The study samples were selected using total sampling technique. A questionnaire sheet was used to collected data through interviews. Data analysis applied the Chi-Square test. The test result revealed a correlation between age (p value = 0.032), working hours (p value = 0.004), and workload (p value = 0.000) with work fatigue among office workers. It can be concluded that there was a correlation between age, working hours, and workload with work fatigue in office workers.

Early Marriage in Babat District, Lamongan Regency

Thu, 02 Jan 2025 00:00:00 +0700

A problem frequently occurring in society is the prevalence of early marriage. Early marriage is a marriage performed by women and men who are not yet of legal age to marry. Marrying with an immature age cannot take place optimally both financially, mentally, and psychologically, and may be easier to experience problems after marriage. This research aimed to determine the factors causing early marriage in Babat district, Lamongan regency. This research was an analytical correlation using a cross sectional approach on 37 families who married at the age of <19. A questionnaire instrument was used to determine the factors causing early marriage in families who married at <19 years of age. The data were analyzed by using SPSS. The Spearman’s rho test was used to test the relationship between factors causing early marriage. The incidence of early marriage in Babat district had a high level of education of 57%, low family economic status of 51%, parental encouragement of 62.1%, and culture of 62%. These factors were related to the incidence of early marriage. It is hoped that adolescents who received good information, knowledge, and understanding regarding early marriage will avoid committing this act.

Characteristics, Family Support and Medication Compliance in Elderly People with Hypertension

Heri Sugiarto, Mutia Futikha, Sri Wahyuni, Alfan Afandi, Bambang Budi Raharjo — Thu, 02 Jan 2025 00:00:00 +0700

One of the NCDs that many Indonesian people suffer from is hypertension. Hypertension is a blood circulation system disorder that results in an increase in blood pressure above normal or ≥140/90 mmHg. One of the factors controlling hypertension is the behavior of adherence to taking hypertension medication, but up to now adherence to medication in hypertension sufferers is still a problem that can have an impact on increasingly chronic disease and the occurrence of complications. The aim of this research is to determine the characteristics and family support. , and compliance with taking hypertension medication in hypertensive elderly in Banyubiru Village. This type of research is descriptive quantitative with a sample size of 88 respondents taken from a population of 160 elderly people with hypertension, using a simple random sampling method. The instrument used in this research was a questionnaire. Based on the research results, it can be seen that the majority of respondents aged 60-70 years were 68 respondents (77.3%). The frequency distribution based on gender is predominantly female with 49 respondents (55.7%). Meanwhile, the frequency distribution based on education level is mostly elementary school with 36 respondents (40.9%). Frequency distribution based on family support, 46 respondents (52.3%) did not support it. Frequency distribution based on compliance behavior in taking hypertension medication, there were 48 respondents (54.5%) who were non-compliant in taking hypertension medication. Non-compliance with taking anti-hypertension medication among elderly people with hypertension is still relatively high, so further health promotion efforts are needed to increase compliance.

Optimization of Breastfeeding Support Groups in Breastfeeding Self-Efficacy

Ihda Mauliyah, Widya Hary Cahyati, Oktia Woro Kasmini Handayani — Thu, 02 Jan 2025 00:00:00 +0700

Breastfeeding Self-Efficacy (BSE) is a mother's belief in her ability to breastfeed her baby and determines whether she chooses to breastfeed. The presence of a breastfeeding support group can offer assistance and inspire mothers, leading to improved breastfeeding self-efficacy. The research design employed a Pre-Experimental design with a One-Group Pretest-Posttest Design methodology. The study included pregnant women in the third trimester through the postpartum period (6 weeks) and 40 breastfeeding mothers. An initial evaluation assessed Breastfeeding Self-Efficacy in pregnant women. The intervention involved establishing a breastfeeding support group and providing coaching to assist and educate postpartum mothers. Subsequently, a follow-up assessment of breastfeeding self-efficacy was conducted among postpartum mothers. Data analysis utilized the Wilcoxon Sign Rank Test, revealing a significance level (p) of 0.046 < α = 0.05. The study found a significant relationship between breastfeeding self-efficacy before and after participation in a breastfeeding support group. The findings demonstrate a notable impact on breastfeeding self-efficacy pre and post the involvement of the breastfeeding support group, underscoring the necessity of such groups for enhancing Breastfeeding Self-Efficacy.

The Comparative Antioxidant Capabilities from Vitamin C and Betanin on The Liver and Renal for Reducing Oxidative Stress Damage: An Animal Experimental Study

Thu, 02 Jan 2025 00:00:00 +0700

Formaldehyde is a hazardous chemical substance that can be found commonly in the environment which has various effects and could induce the production of pro-oxidant substances inside the body. When the concentration of pro-oxidant substances is higher than the concentration of antioxidant substances, it could induce the occurrence of oxidative stress. During oxidative stress, antioxidant play an important role to neutralized harmful effect of free radicals and minimized cellular changes, for examples vitamin C and betanin. The study was conducted to test the differences in the protective effects of vitamin C and betaine on the liver and the kidney after long-term exposure to oxidative stress. The study used rats as experimental media by giving exposure to formaldehyde that is known to induce oxidative stress. The rats were exposed to formaldehyde 6 hours a day for 12 weeks while being given water, vitamin C, and betanin interventions. After 12 weeks of treatments, histopathological examinations were assessed in the liver and kidney organs to compare the protective effects of vitamin C and betanin in those 2 different organs. The results of histopathological examinations revealed that there is a difference in the response to antioxidant therapy between vitamin C and betaine to the liver and kidneys.

The Role of Health Education in Preventing Incidents of Diabetic Ulcers in Type 2 Diabetes Mellitus

Thu, 02 Jan 2025 00:00:00 +0700

Type 2 Diabetes Mellitus (T2DM) increases globally every year, along with the increase in DM, the incidence of diabetic ulcers also increases. Education is an important pillar because it can increase health literacy, namely increasing knowledge and ability to manage self-care for DM sufferers. This study aims to determine the impact of health education on preventing diabetic ulcers in diabetes mellitus patients. This type of research is quasi-experimental and was designed using a pre and post test group design with an intervention group. The research was conducted for 9 months, the study population was 325 T2DM people in Pringsewu Regency. The total sample was 107 T2DM people and the sample was determined using a purposive sampling technique. The research results show that the determining factor for the occurrence of diabetic foot ulcers is foot care activities, p-value = 0.000 with OR: 42.778. Evaluation at 36 weeks after intervention showed a decrease in signs of diabetic foot ulcers (86.0%). Conclusion; Health education can prevent the occurrence of diabetic ulcers in Diabetes mellitus. Suggestion: T2DM sufferers are advised to take proper foot care so that diabetic foot ulcers can be prevented.

Systematic Literature Review (SLR): Utilization of Social Media as a Health Promotion Tool

Jumriyanti Nasaru — Thu, 02 Jan 2025 00:00:00 +0700

Social media is one of the digital media that is widely used by people almost all over the world. In maximizing social media as a health promotion tool, it is expected that health information can be easily obtained and understood by the community. This study aims to see how the utilization of social media as a health promotion tool. The research method used was the Systematic Literature Review (SLR) by conducting a literature review on journals related to social media and health promotion. The results of the literature review showed that social media is effectively used as a health promotion tool because it can increase public knowledge and awareness about health. However, the utilization of social media must be accompanied by the delivery of valid information and come from health workers according to their fields of expertise.

Digital Transformation in Cancer Care: Improving Accessibility and Efficiency of Patient Care in Remote AreasThe rapid advancement of digital technology has had a significant impact on healthcare services, particularly in cancer care, which is one of the

M. Fahrurozi — Thu, 02 Jan 2025 00:00:00 +0700

The rapid advancement of digital technology has had a significant impact on healthcare services, particularly in cancer care, which is one of the leading causes of death globally. Despite ongoing innovations, access to quality cancer care in remote areas remains limited, with major challenges in diagnosis, treatment, and monitoring. This study aims to explore the role of digital transformation in enhancing the accessibility and efficiency of cancer care in remote areas, focusing on telemedicine, mobile health applications, and digital health monitoring tools. This research uses a quantitative approach through a literature review by analyzing various relevant sources such as scientific journals, research reports, and health policies related to the implementation of digital technology in cancer care. The quantitative data obtained from the relevant literature shows that the application of digital health technology has improved access to timely cancer diagnosis and treatment, reduced travel time, and minimized treatment delays. Additionally, the use of telemedicine platforms has been reported to improve communication between patients and healthcare providers, while mobile applications enable patients to actively monitor their health conditions, thus increasing adherence to treatment protocols. In conclusion, digital transformation in cancer care offers an effective solution to address healthcare service gaps in remote areas, although better digital infrastructure and increased technological literacy are needed to maximize its benefits. This study provides valuable insights for policymakers and healthcare providers in integrating digital solutions to enhance the resilience of the healthcare system, especially in underserved regions.

Calcium Supplementation in Blood Calcium Levels and Paresthesia Events in Thrombopheresis

Thu, 02 Jan 2025 00:00:00 +0700

The use of anticoagulants in the process of thrombopheresis aims to make the blood flow smoothly. In the use of anticoagulants citrate, it is necessary to pay attention to the occurrence of hypocalcaemia. Efforts are needed to minimise the impact of hypocalcaemia both arrhythmias and parasthesias during thrombopheresis by giving calcium tablets. The purpose of this study was to determine the effect of oral administration of Calcium tablets on blood calcium levels and the incidence of paresthesia in Thrombopheresis donors.This type of research is true experiment with pre posttest control group design. The treatment group was given calcium tablets before thrombopheresis and the control group was not given calcium tablets before thrombopheresis. All statistical analyses were performed using IBM SPSS for Windows, version 20 (IBM Corp, Armonk, NY, USA). Whereas categorical data were given as numbers and proportions, continuous variables were reported as the median and quartile. The correlation was discovered through binary logistics. It was deemed statistically significant when P < 0.05.Blood calcium levels between the two groups of results Analysis using independent T test showed no significant difference, namely p value 0.67. The incidence of paresthesias between the two groups, both groups that consumed calcium tablets and groups without calcium tablet consumption, from the results of the Chi-Square test showed a significant difference, namely p value 0.003.The conclusion in this study is that there is a significant difference in the average decrease in blood calcium between the group that consumes calcium tablets and the group that does not consume calcium tablets. The incidence of paresthesias There was a significant difference between the groups that consumed calcium tablets and the groups that did not consume calcium.

Prediction Dengue Fever Cases Semarang City Indonesia

Thu, 02 Jan 2025 00:00:00 +0700

Dengue fever is often in the spotlight in Indonesia every year. Data from the Ministry of Health shows that until the 17th week of 2024, there were 88,593 cases of dengue fever with 621 deaths in Indonesia. Semarang City is still an endemic dengue case, so a comprehensive control of the incidence of cases in the community is needed through the calculation of case predictions. To predict the number of dengue fever cases per month per sub-district and compare with the real cases that occurred during January - August in 2024. We used the exponential smoothing method in this study. Data source: The data used is dengue fever case data taken from the dengue fever information system report (Tunggal Dara) for the period 2016-2023. The variables included include the number of cases per month, the population, and sub districts, while the data set obtained is 1616 data. The prediction of DHF cases per month for 2024 per sub-district area was produced, with an average MAE value of 1.55, indicating that the average difference between the predicted value and the observed number of DHF patients is relatively small. The average value of alpha in smoothing coefficients is 0.286, meaning that the influence of the latest data on the predicted value has a moderate weight. Tugu sub-district had an RMSE value of 1.101, meaning that the predicted values were close to the real cases and during the 8 months of observation, the results were correct. The prediction of cases per month per sub-district is used for prevention efforts against the occurrence of DHF cases, the hope is not to exceed the predictions produced. If it can be below the prediction results, it means that there is a success of promotive and preventive efforts made by all parties.

Patterns of Non-Communicable Diseases in Semarang City: Descriptive Analysis Based on Public Health Data

Thu, 02 Jan 2025 00:00:00 +0700

Non-communicable diseases (NCDs) remain a major health issue both globally and nationally. According to the WHO, NCDs cause 41 million deaths each year, accounting for 74% of all global deaths.The high prevalence of NCDs can lead to decreased productivity and disruptions in daily activities.. Therefore, effective and sustainable prevention and control efforts are necessary to address these issues and support the achievement of health development goals in Indonesia. To conduct a comprehensive descriptive analysis of non-communicable diseases (NCDs) cases in the city of Semarang, identifying and highlighting key trends and patterns that emerge from the data. This study employs a descriptive analysis approach. Data source: The data used is Non Communicable Disease case data taken from the 39 Public Health Centers Electronic Health Record’s (SIMPUS) of Semarang for the period 2020-August 2024. The data was collected, cleaned, and normalized before analysis. The result were visualized to identify trends and pattern and were integrated in dashboard intelligent visualization system. The total number of NCD cases in the study period was 155,720, the analysis revealed that the highest number of non-communicable disease cases in Semarang City occurred in July 2024 (16,940 cases), with the lowest in May 2020 (7,688 cases). Hypertension and non-insulin-dependent diabetes mellitus were the most common conditions. Geographically, Tembalang sub-district had the most NCDs cases (15,362), with Sendangmulyo village leading within sub-districts (2,772 cases). Women accounted for the majority of cases, totaling 95,985 (61,7%). Most non-communicable disease patients suffered from hypertension and non-insulin- dependent diabetes mellitus. The interventions are recommended, particularly in high-incidence areas like Tembalang and Sendangmulyo, focusing on hypertension and diabetes mellitus non-insulin. The findings can influence urban health policy, healthcare resource allocation, and community health programs, while also guiding future studies on climate change, healthy behaviour, and urbanization's impact on health outcomes.

Psychotherapy Cognitive Behavioral Therapy and Pharmacotherapy in Depression Patients Evidence Base Case Report

Soesmeyka Savitri, Reksoyudo Dwi Pradipo — Thu, 02 Jan 2025 00:00:00 +0700

Depression is a mental problem that generally occurs at various ages. Depression in children and adolescents is almost similar to conditions in adults in general. It is estimated that in 2030 according to the World Health Organization (WHO), depression can be a problem for middle to developed countries. A case of depression in a female patient aged 20 years received combination therapy with pharmacotherapy in the form of sertraline 50 mg/24 hours orally and Cognitive Behavioral Therapy (CBT). The aim of this study is to compare pharmacotherapy with CBT to increase the awareness of therapists to develop treatment for depression in patients in future studies. The search was conducted using the PubMed, Cochrane, Tripdatabase, Medscape databases using the search keywords Depression AND Pharmacotherapy AND Psychotherapy AND Cognitive Behavioral Therapy. The search was restricted to using a screening of journals published in the last 10 years, subject to human research. The results showed that SSRIs are suitable therapy combined with CBT in depressed patients. The study also found that the combined effect of CBT and pharmacotherapy can accelerate the healing effect and prolong remission in depressed patients.

The Relationship between Stunting Conditions and the Incident of Caries in Children: A Mini Review

Yunita Dyah Puspita Santik, Ari Yuniastuti, Mahalul Azam, Siti Harnina Bintari — Thu, 02 Jan 2025 00:00:00 +0700

This study explores the relationship between stunting conditions and the incidence of dental caries in children. Stunting, a condition characterized by impaired growth and development, is often associated with nutritional deficiencies. Dental caries, on the other hand, are caused by bacterial erosion of tooth enamel. The mini review aims to investigate whether there is a correlation between these two health issues in children. Findings indicate a significant association between stunting and dental caries. Children who are stunted are more likely to experience tooth decay and other oral health problems. This correlation is attributed to several factors, including nutritional deficiencies, compromised immune system, reduced saliva production. The findings from these studies highlight the importance of addressing both stunting and dental caries to ensure the overall health and well-being of children. Early intervention and preventive measures are crucial in preventing and mitigating these conditions. Future research should focus on developing effective strategies to address both stunting and dental caries in children, particularly in vulnerable populations.

The Relationship between Pesticide Exposure and Impaired Lung Function in Horticultural Sprayer Farmers in Ngablak District, Magelang Regency

Muhammad Dwian Rahadi — Thu, 02 Jan 2025 00:00:00 +0700

Pesticides can cause air pollution in farmers' workplaces. One of the effects of pesticide spraying is impaired lung function. This study aims to determine the relationship between pesticide exposure and impaired lung function of horticultural spraying farmers in Ngablak Magelang.The research design is an observational study using a Cross Sectional approach and 70 people as a sample. The population of this study is farmers who are members of the Sumberejo village farmer group. The research sample from this study is farmers in Sumberejo village who meet the inclusion criteria. The data collected used a questionnaire as an instrument, while the examination of pulmonary dysfunction used a spirometry. The data analysis used in this study is chi square and logistic regression.The findings of this study are related to lung function disorders, such as: length of work (p-value=0.004), duration of work (p-value=0.001), frequency of spraying (p-value=0.32).

Digital Innovation Through Early Detection Skills for Adolescent Mental Health in School Environments

Febriantika Febriantika, Haryono Haryono, Asnita Yani — Thu, 02 Jan 2025 00:00:00 +0700

Digital technology has emerged as a promising tool to overcome barriers to accessing mental health services, reduce stigma, and increase flexibility in early detection, particularly among school adolescents. This study aims to evaluate how digital technology contributes to the early detection of mental health issues, serving as a preventive strategy against drug abuse and bullying in school environments. Using a qualitative approach through a literature review, the research examines recent studies on various digital tools such as online psychotherapy applications, mental health chatbots, and telemedicine. The findings suggest that these technologies significantly enhance access to mental health services, especially in low- and middle-income countries with limited traditional resources. Digital platforms enable early identification of issues like anxiety and depression, improving intervention opportunities before problems escalate. However, several challenges need to be addressed, including ensuring technological accuracy, improving user competencies, and establishing comprehensive regulatory frameworks. The study highlights the importance of cross-sector collaboration, particularly between educators, health professionals, and policymakers, to ensure effective implementation. Recommendations include teacher training and the development of inclusive, user-friendly platforms that are adaptable to various educational contexts. Addressing these challenges is crucial for maximizing the potential of digital tools in supporting mental health initiatives in schools.

Strengthening Management of Stunting in Toddlers through Training on Nutrition and Local Food Processing using Catfish for Posyandi Cadres and Mothers of Toddlers

Neni Neni, Andik Setiyono, Yuldan Faturahman — Thu, 02 Jan 2025 00:00:00 +0700

Stunting is a condition that reflects failure to grow in children. Efforts to detect and prevent stunting by conducting training on local food processing made from catfish as an effort to increase knowledge and skills in providing nutrition for toddlers with the hope that the stunting rate in the Purbararatu area will decrease and turn into an improved and good nutritional status. The important role of posyandu cadres is that training is needed to increase knowledge and skills so that they can manage stunting appropriately. The implementation method used in this activity is by providing training to cadres, namely by explaining stunting management items, training in preparing food menus for toddlers to cadres and mothers of toddlers, and training in processing local food made from catfish. This research uses a One-Group Pre-test-post-test design, namely giving an initial test (Pre-test) before being given counseling, after being given counseling then giving a final test (Post-test) to determine whether there is an increase in knowledge. The total population in this study was 20 people consisting of cadre mothers and mothers of toddlers. Based on the calculation results, the average pre-test score is 66.00 and the average post-test score is 75.00. Based on the results of the difference test above, a p-value of 0.000 (< 0.05) was obtained, which means there is a difference between the pre-test and post-test scores or there is an influence of providing material on increasing cadre knowledge. It is hoped that from the results of this community service, cadres will be able to increase their knowledge regarding stunting management, prepare the correct food menu for toddlers, become skilled in processing local food made from catfish, so that it becomes a local product high in protein that can be used to cover nutrition for toddlers as well as their numbers. stunting cases are low.

Social Support in the Prevention of Postpartum Mood Disorder

Ponco Indah Arista Sari, Widya Hary Cahyati, Irwan Budiono — Thu, 02 Jan 2025 00:00:00 +0700

Postpartum is a transitional period of changes both physiologically and psychologically. Mothers are expected to adapt to all the changes. In undergoing this postpartum period, mothers need a lot of support, especially from the people and environment closest to them. Mothers will be able to carry out their role well if they are well adapted. Poor adaptation certainly causes uncomfortable condition which will affect psychologically. Frequently occurring psychological problems in postpartum mothers include baby blues and postpartum blues, and if it cannot be managed, it will lead to postpartum depression. This study aimed to determine the relationship of social support in the prevention of postpartum mood disorder. The research used descriptive analytic method with cross sectional design using a total population of 46 postpartum women. The data were analyzed univariate using frequency distribution tables and bivariate with cross tabulation and Chi square. The results of this study indicated that mothers who received good social support and did not experience postpartum mood disorders were 21 people (78%). Mothers who received less social support and did not experience postpartum mood disorders were 4 people (21%). The results also indicated p value < α where 0.000 < 0.05, meaning that social support could prevent postpartum mood disorders. From these results, it can be concluded that it is necessary to provide social support to postpartum mothers as an effort to prevent postpartum blues. Social support from the environment including spouses, family, relatives, friends and health workers is considered to have an effect on reducing postpartum mood disorders.

Occurrence, Contributing Factors, and Impact of Fear of Missing Out (FOMO) in Workers: A Systematic Literature Review

Raharjo Apriyatmoko, Abdul Wakhid, Faridah Aini — Thu, 02 Jan 2025 00:00:00 +0700

Fear of Missing Out (FOMO) is a set of psychological symptoms associated with social media use. Various studies show that FOMO is a health problem that can occur to everyone because it is inevitable that today almost everyone relies on communication technology, especially mobile phones, in their social interactions by accessing various social media platforms, including work activities. Studies that have been conducted still focus on FOMO among adolescents, students, and very limited studies on workers. Through a systematic literature review, the phenomenon of FOMO in workers is described in the form of occurrence, contributing factors, and impact. These results can be used as a basis for various stakeholders including health professionals to develop prevention and mitigation programs for FOMO so that workers' health can be improved.

Determinants Of Maternal Death Rate In Lamongan District, East Java Province, Indonesia

Ratih Indah Kartikasari, Widya Hary Cahyati, Irwan Budiono — Thu, 02 Jan 2025 00:00:00 +0700

Maternal mortality is still a hot issue worldwide and in Indonesia. Maternal Mortality Rate (MMR) is an indicator of public health status where according to WHO the causes of MMR are largely preventable. Pregnancy complications are the highest cause of MMR. The purpose of the study was to determine what determinants were associated with maternal mortality in Lamongan Regency from 2020 to 2022. This study used an analytical descriptive method with a cross-sectional approach. The data used was secondary data from the Lamongan Regency Health Profile in 2020, 2021 and 2022. The instrument used an observation sheet. Data were analyzed using bivariate and univariate analysis. There was an upward trend in MMR in Lamongan Regency from 2020 to 2021 and then experienced a sharp decline in 2022. Maternal age did not have a significant relationship as an indirect cause of MMR, but maternal age correlated with the incidence of bleeding as a direct cause of maternal death. The age determinants of maternal mortality were more than half in the healthy reproductive age range of 20-34 years at 57.7%. The direct causes of maternal mortality were not significantly associated with MMR. The cause of MMR was almost partly due to other causes at 42.2%. Almost half of obstetric complications in Lamongan Regency in 2022 were anemia at 39.6%. The direct causes of maternal mortality were not significantly associated with MMR in Lamongan Regency. MMR can be reduced through efforts to detect early pregnancy complications and improve maternal health services. Efforts to prevent pregnancy complications can be made with good self-care during pregnancy and supported by the environment. Therefore, health promotion efforts should begin before pregnancy so that the results are more optimal.

Implementation of Effective Communication in Improving Patient Safety Standards at Jasa Kartini Tasikmalaya Hospital

Rian Arie Gustaman, Syifa Fuadatul Muntaha — Thu, 02 Jan 2025 00:00:00 +0700

Patient safety is a top priority in hospitals; however, it is often hindered by poor communication among healthcare professionals. According to Minister of Health Regulation No. 11 of 2017, the patient safety system must ensure the provision of safe care. At Jasa Kartini Hospital in Tasikmalaya, there were 76 incidents attributed to poor communication from 2021 to 2023, with new communication standards reaching only 40% compliance. This study aims to analyze effective communication in support of patient safety standards at the hospital. A qualitative approach was employed using a case study design, with subjects selected through purposive sampling, consisting of eight individuals with relevant experience. Data were collected through in-depth interviews. The results indicated that communication when receiving instructions via telephone was in accordance with the KARS Accreditation Survey Instrument. However, obstacles emerged due to changes in the electronic medical record system and high staff turnover, which affected nurses' understanding of the provided instructions. In reporting critical diagnostic results, although the process was detailed and effective, there was a discrepancy in the reporting time frame: 60 minutes instead of the 30 minutes stipulated by KARS standards. For handover communication, the application of the SBAR method proved effective in ensuring continuity and smoothness of nursing tasks. Overall, while communication in the hospital met most accreditation criteria, improvements are still needed to address existing obstacles, particularly in system operations and staff training.

The Effectiveness of Baby Massage on Weight Gain in 6-Month-Old Babies in Ciawang Village, Lewisari District, Tasikmalaya Regency

Russiska Russiska, Handayani Eko Suko Rahayu — Thu, 02 Jan 2025 00:00:00 +0700

The golden age is a critical period in growth and development, occurring at the age of 0-12 months. This period is very fast and cannot be repeated. In infancy – toddlers, weight can be used as an indicator of growth rate and nutrition in children. Data in Ciawang Village shows that out of 98 babies aged 6 months, 63 babies did not experience weight gain. One of the efforts to increase weight in babies is to do baby massages. This study aims to analyze the effectiveness of baby massage on weight gain in 6-month-old babies in Ciawang Village, Leuwisari District, Tasikmalaya Regency. This type of analytical survey research uses the Quasi-Experimental one-group pre-test-post-test design approach. The variables used include the free variable, namely baby massage, and the bound variable of baby weight gain. The population is 6-month-old babies in Ciawang Village, as many as 19 people. Data was obtained by observation, and then analyzed using the paired test. The average weight of a 6-month-old baby before the baby massage was 6092.11 grams. After doing a baby massage, the average is 6339.47 grams. The average weight gain of babies was 247.37 grams. The results of the bivariate test obtained a Pvalue value of 0.001. Baby massage effectiveness on weight gain in 6-month-old babies. Advice for midwives to be able to carry out midwifery interventions to increase the baby's weight through the provision of massage techniques.

Determinants of Adolescent Reproductive Health Literacy in SMP N II Jambu Semarang Regency, Central Java

Eti Salafas, Haryono Haryono, Ignatius Paundra Oktaviatmoko, Eri Trisnawati — Thu, 02 Jan 2025 00:00:00 +0700

Adolescent reproductive health is a significant concern, as adolescents undergo both physical and psychological changes during their transition from childhood. A lack of reproductive health literacy among adolescents can increase the risks of teenage pregnancy, sexually transmitted infections (STIs), and other related issues. This gap in reproductive health literacy is influenced by several factors, including the support provided by teachers through peers and family members. This study aims to analyze the determinants of adolescent reproductive health literacy, focusing on the support factors from teachers, healthcare providers, families, and peers, and their correlation with the level of reproductive health literacy among adolescents at SMP N II Jambu, Semarang Regency. This research adopts a quantitative approach with a cross-sectional design, involving 151 students from SMP N II Jambu, Semarang Regency, selected through simple random sampling. Adolescent reproductive health literacy is measured using the modified Health Literacy Measure for Adolescents (HELMA). The data were analyzed using univariate analysis with frequency distribution and bivariate analysis with the Chi-Square test. The study found a significant correlation between the support of teachers, healthcare providers, family, and peers, and the level of adolescent reproductive health literacy at SMP N II Jambu, Semarang Regency. To enhance adolescent reproductive health literacy in schools, there is a need for increased support from teachers, healthcare providers, family members, and peers.

Depression Postpartum: Bibliometric Analysis

Siti Rafika Putri — Thu, 02 Jan 2025 00:00:00 +0700

The prevalence of postpartum depression continues to increase annually. Approximately 13%-18% of mothers worldwide who experience postpartum depression exhibit severe depressive symptoms and seek treatment. Untreated postpartum depression significantly increases the risk of developing depression beyond the postpartum period, making these individuals six times more likely to suffer from depression later in life. This study aims to identify and analyze academic literature on postpartum depression and to explore emerging research trends, leading authors, co-authorship networks, institutions, countries, and journals. Methods: Scopus was utilized to collect relevant articles on postpartum depression published from January 1925 to September 27, 2024. All titles were screened to ensure they met inclusion criteria, with the primary requirement that the titles be in English. All bibliographic information was extracted and used for descriptive analysis. Bibliometrics and VOSviewer were used to compile and visualize annual publication totals, journals, authors, countries, institutions, collaboration networks, keywords, and references. In total, 13,383 articles met the inclusion criteria. The number of publications annually indicated an increasing trend, although there was a decrease in the last two years, 2023 and 2024. The journals with the most publications were the Journal of Affective Disorders, Archives of Women's Mental Health, and BMC Pregnancy and Childbirth. The most productive countries were the United States, the United Kingdom, and Canada. The most prolific institutions included the University of Toronto, the University of North Carolina at Chapel Hill, and the University of Melbourne. The most productive researchers were Wisner, K.L., Meltzer-Brody, S., and Dennis, C.L. Conclusions: This study summarizes recent advances in postpartum depression research and highlights emerging trends, sources, leading institutions, and hot topics through bibliometric analysis and network visualization. Although this study has unveiled new knowledge in healthcare, it will provide valuable insights relevant to future research directions and clinical practice.

A Study of Educational Services and Preferences for Long-Term Contraceptive Use in Women: A Systematic Literatur Review

Ana Sundari, Siti Harnina Bintari, Dina Nur Anggraini Ningrum, Eko Farida — Thu, 02 Jan 2025 00:00:00 +0700

Family planning interventions focus on the use of long-term contraceptives for determining pregnancy spacing and improving maternal and child health. In developed countries, although the number of unwanted pregnancies has decreased, almost half of all pregnancies are estimated to be unwanted. This represents that the counseling methods carried out by service providers are still ineffective. The aim of this study is examine more deeply the study of educational services and preferences for long-term contraceptive use in women as a program evaluation material that can then be adapted and developed into more effective services. This systematic review was written based on the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guideline through two electronic databases, Science Direct and Sage Journal. The keywords used were "Couples of Childbearing Age" AND "Education/Counseling" AND "Intervention Long-Term Contraceptives Implants" OR "IUDs" OR "Condoms" OR "Hormonal Contraception" so that 15 articles were analyzed. The result show that the access to contraception and contraceptive selection should be supported by insurance & service providers should offer counselling on and access to a wide range of contraceptives in their place, proven pharmacist prescriptions for increased contraceptive availability that support the determination of long-term contraceptive use in women, checks on health websites about contraceptive use e.g. on university websites, doctors, and apps like Health-E You. In addition, the use of tools such as the postpartum intrauterine contraceptive device (PPIUCD), AKDR LNG 13.5 mg, and the use of a suction cervical stabilizer during IUD insertion. The education about contraception needs to be carried out by providing counseling, both by doctors, pharmacists, insurance companies, as well as access to health websites and applications.

The Relationship Between Instant Noodle Consumption and the Proportion of Hypertension Aged >18 Years According to Provinces in Indonesia

Taqiyla Aziza Kesiananda, Dina Nur Anggraini Ningrum — Thu, 02 Jan 2025 00:00:00 +0700

One of the triggers for hypertension is unhealthy eating patterns, such as high levels of salt which are generally found in instant foods. In Indonesia, instant food has a fairly high consumption level, one of which is instant noodles. The level of instant noodle consumption in Indonesia reached 60.7% within a period of 1-6x/week based on data from the 2023 Indonesian Health Survey. The aim of the research was to analyze the relationship between percentage instant noodle consumption and percentage of hypertension in the population aged >18 years according to provinces in Indonesia. The research used a cross-sectional design using data from the 2023 Indonesian Health Survey. The population used was data from 38 provinces in Indonesia. The sample size is the population aged over 18 years according to provinces in Indonesia. The analysis used is the Pearson correlation test. Based on data, it shows that the highest frequency of instant noodle consumption is in South Sulawesi Province (72%) and the lowest in Mountainous Papua Province (45%). The incidence of hypertension in people aged >18 years is highest in Central Kalimantan Province (40,7%) and the lowest in Mountainous Papua Province (19,9%). The results of statistical tests with Pearson correlation showed that there was a positive relationship between instant noodle consumption and the incidence of hypertension (p=0.039; R=0.336). In conclusion, there is a relationship between instant noodle consumption and the incidence of hypertension.

The Impact of Preeclampsia on Mothers and Perinatal

Lilin Turlina, Mahalul Azam, Widya Hary Cahyati, Feddy Setyo Pribadi — Thu, 02 Jan 2025 00:00:00 +0700

Preeclampsia is an obstetric syndrome, a multisystem disorder affecting 2%-5% of pregnant women and a major contributor to both maternal and perinatal morbidity and mortality globally. This current study aimed to analyze the impact of preeclampsia on mothers and perinatal. This cross-sectional study was performed at Muhammadiyah Lamongan Hospital, using secondary data from January 2023 to February 2024. The sample was 192 delivering mothers, consisting of 96 delivering mothers with preeclampsia and 96 normal delivering mothers. The data were processed using multiple logistic regression. The statistical test showed that delivering mothers with preeclampsia had 85.7 times higher risk to undergo SC delivery (OR 85.706, 95% CI: 19,870 - 369,670), 5.5 times higher risk to deliver prematurely (OR 5.500, 95% CI: 2. 377 - 12,727), 4 times greater to deliver a baby with LBW or <2500 grams (OR 4,300, 95% CI: 1,971 - 9,383), 2 times higher to deliver a baby with APGAR Score < 7 in the first 5 minutes (OR 2,000, 95% CI: 1,116 -3,584). It is hoped that healthcare workers can carry out early detection for the prevention of preeclampsia and carry out immediate management to reduce morbidity and mortality in mothers and perinatal.

Characteristics of Mothers, Mothers' Motivation, and the Role of Community Health Workers in Relation to Mothers' Participation in Toddler Classes in Gogodalem Village

Vistra Veftisa, Shinta Lutfiani — Thu, 02 Jan 2025 00:00:00 +0700

Child growth issues require special attention. According to the Riskesdas 2018, the prevalence of stunting in Indonesia reaches 30.8% and wasting is 10.2%. Bappenas 2018 reported that nutrition problems in toddlers are at 30.8%, which does not meet the RPJMN target to reduce malnutrition and stunting to 28%. The Bringin Health Center ranks second with a high nutrition problem rate of 9.7%. The toddler class program is one of the government’s efforts to address this issue. In Gogodalem Village, the target for toddler classes has not reached 100% because not all target participants attend, and the attendance of cadres is inconsistent. This study was conducted to determine the relationship between maternal characteristics, maternal motivation, and the role of cadres with mothers' participation in toddler classes in Gogodalem Village, Bringin District. This study uses a correlational analytical design. The population in this study consists of mothers with toddlers aged 0-59 months from February to June 2024, totaling 219. The sample for this study was 69 respondents, determined using the Slovin formula, with a sampling technique of proportionate random sampling. Data collection tools included questionnaires and attendance reports from toddler classes, with data analysis using the chi-square test. The results show that maternal characteristics related to participation in toddler classes include maternal age with a p-value of 0.001, a relationship with maternal motivation with a p-value < 0.0001, and the role of cadres with a p-value of 0.014 in relation to mothers' participation in toddler classes.

School Health Promotion Survey to Evaluate School Well-Being between Male and Female Students at Full-Day School Al Azhar Islamic Elementary School 29 BSB Semarang

Wening Wihartati — Thu, 02 Jan 2025 00:00:00 +0700

School well-being is one of the benchmarks for one's welfare, more precisely being able to predict the level of welfare of students who are living school life. In the world of education, which is supposed to create security and well-being for students, there are many cases appeared that cause physical and psychological harm. The majority of schools in Indonesia only focus on academic achievement, this has an impact on the exclusion of the value of school well-being that should be obtained by students in school life. This type of research is a field research, with an approach that is a quantitative descriptive approach. A quantitative approach was used to collect data from the questionnaire. The research location was in SD Islam Al. Azhar 29 BSB Semarang with a total of118 students as the respondents. The data collection technique in this study used the School Health Promotion Questionnaire on School Well-being from Konu and Rimpela (2002). The results of the study for female students showed that the aspect of having the highest percentage in two items, namely the crowd in the class, was very disturbing as much as 33%. For the highest loving aspect is being depressed with a long time in school as much as 35%. For the aspect of being, female students stated that they had never received help from school or home when they had learning difficulties or were unable to attend lessons by 35%. For health-related aspects, students stated that experiencing respiratory tract disorders such as flu, cough and colds as much as 42% occurred two or three times a week. For male students, the results are as follows: for the having aspect in this survey, the highest percentage of things that are still lacking is that the crowd in the class is quite disturbing as much as 34.5%. The aspects of being that need to be considered in disagreeing if the teacher encourages students to express opinions as much as 34% and sometimes gets help if they have problems in learning or cannot attend lessons as much as 44%.

Effectiveness of the Combination of Jumping and Throwing Games: “Catch the Ball” on the Development of Gross Motor Skills in Preschool Children

Thu, 02 Jan 2025 00:00:00 +0700

The 2018 Basic Health Research (Riskesdas) results showed that the percentage of children with impaired gross motor development in Indonesia was 12.4% and that of fine motor development was 9.8%. The achievement of children's motor development in Central Java according to Riskesdas data in 2018, reached 98.4% [1]. Activities that can stimulate abilities are needed to improve gross motor skills, for example, by providing stimulation. The purpose of this study was to determine the effect of stimulation with a combination of jumping games and throwing catching balls on gross motor development in preschool children in kindergarten class A KBIT-TKIT As Salaam Mijen. This type of research is a Quasy-experiment with a one group pretest-posttest design. The population in this study were all children in the kindergarten A class of KBIT-TKIT As Salaam, Mijen District, Semarang City, totaling 65 people. Data collection was done by filling out the gross motor assessment observation sheet. Data analysis in this study used the Willcoxon test. The results showed that the average value of gross motor before being given a combination of jumping games and throwing the ball was 9.26 and after being given the average value was 9.68. From these results, it shows that there is an increase in the average value of 0.42. After the Willcoxon test, it can be concluded that there is an effect of a combination of jumping games and throwing catching the ball on gross motor skills with a p value = 0.000. For parents are expected to be able to better understand children's development, especially gross motor development and be able to provide stimulation to children so that there are no disruptions or delays in children's gross motor development.

Preeclampsia Increases the Risk of Low Birth Weight, Case-Control Study at Gondo Suwarno Ungaran Hospital

Yulia Nur Khayati, Anissa Regita — Thu, 02 Jan 2025 00:00:00 +0700

Hypertensive disorders in pregnancy are conditions where the systolic blood pressure of pregnant women exceeds 140 mmHg and the diastolic blood pressure exceeds 90 mmHg. Hypertension in pregnancy has several types including pre-eclampsia or eclampsia, chronic hypertension during pregnancy, chronic hypertension accompanied by pre-eclampsia, and gestational hypertension. The cause of maternal death in Indonesia in 2023 is mostly hypertension in pregnancy, which is 412 cases, and in Central Java hypertension in pregnancy is the main cause of maternal death, which is 42.4%. The Health profile has not yet stated what complications in the fetus are caused by hypertension in pregnancy. Severe preeclampsia can cause uteroplacental blood circulation disorders, this will trigger oxidative stress in the placenta, increased uterine tone, and sensitivity to stimuli which ultimately causes complications in the mother and fetus. This study was conducted to find out what effects preeclampsia has on the fetus that is born. This study uses secondary data from Gondo Suwarno Ungaran General Hospital in 2023. The population in this study were all mothers who gave birth in 2023 totaling 945 and a sample of 246 mothers consisting of 82 mothers with preeclampsia and 164 mothers without preeclampsia bivariate data analysis using Chi-Square. The results of this study from the characteristics of the mother which are the factors causing preeclampsia are maternal age with p-value <0.0001 and History of Preeclampsia with p-value <0.0001. Complications in newborns related to Preeclampsia are Low birth weight babies with OR 2.110 (1.087-4.097) while there is no relationship between Preeclampsia and the incidence of Asphyxia in newborns.

Risk Assessment among the Residents of Kampung Kuala Pansoon, Hulu Langat on Nitrate Intake of Gravity Feed System (GFS)

Muhammad Azriq Najmi S S, Shaharuddin Mohd Sham, Zaenal Abidin — Thu, 02 Jan 2025 00:00:00 +0700

The objective research to determine the level of nitrate in the gravity feed system and carry out a health risk assessment of nitrate ex- posure among the residents of Kampung Kuala Pansoon, Hulu Langat, Selangor. Set of questionnaires was administered to 95 respondents in Kampung Kualan Pansoon. The nitrate level in the Gravity Feed System was measured using a HI98191 Professional Waterproof Portable pH/ORP/ISE Meter with an at- tached Ion Selective Nitrate Combination Electrode (ISE) HI4113. The Estimated Daily Intake (EDI) was calculated, and the major differences in exposure and overall likelihood of non-carcinogenic health impacts posed by nitrate in drinking water were addressed by using Hazard Quotient (HQ). The mean nitrate concentration obtained was 7.22 mg/L ± 4.97 (SD), which did not exceed the maximum allowed nitrate concentration in drinking water (10 mg/L). However, seven samples of drinking water exceeded the standard level, while 73.1% of the houses' nitrate concentration was at a safe level. The findings of this study indicate that the Gravity Feed System is generally providing safe drinking water to the community of Kampung Kuala Pansoon. While some individual samples exceeded the nitrate standard, the overall mean concentration was within the acceptable range, and the majority of households had safe nitrate levels. Nevertheless, the presence of nitrate levels above the standard in some samples warrants continued monitoring of the Gravity Feed System. Further investigation is recommended to identify potential sources of nitrate contamination and implement targeted mitigation strate gies.

Health Education Program on Increasing Kindergarten Students’ Knowledge of Insecticide Resistance: Education Through Music and Direct Practice of Making Ovitrap

Thu, 02 Jan 2025 00:00:00 +0700

Based on data from the 2020 Indonesia Health Profile, the incidence of dengue fever in Indonesia in 2020 reached 95,944 cases. According to data recorded until April 2024, the number of dengue cases in Indonesia reached 28,579 people, with 621 deaths. The Central Java Provincial Health Office reported that 5,814 dengue cases in 2023 have been recorded, with a Case Fatality Rate (CFR) of 362 cases. The Karanganyar Regency Health Office noted that the number of Dengue Hemorrhagic Fever (DHF) cases in Karanganyar Regency until the end of 2023 reached 294 cases. Based on data on the distribution of dengue cases in 2024 by age group in the last seven years, the age group of 5 to 14 years is the most vulnerable to dengue which leads to death. In addition, it is likely that insecticide resistance will occur due to the wrong use of insecticides to reduce the presence of mosquitoes. For this reason, health education programs in the community, especially children, in various ways must continue to be carried out as an effort to increase community awareness and role, increase the discovery of larvae and reduce dengue cases. At the same time, the use of insecticides must also be considered. The aim of this community service activity is to increase kindergarten students' knowledge of aedes breeding place, correct use of insecticide to avoid insecticide resistance, and how to make an ovitrap in order to reduce the Aedes mosquito population. This activity was attended by 12 kindergarten students and 12 companions from TK IT MTA Matesih Karanganyar. This implementation of health education was performed through several stages, starting from the giving of health education and counseling through music, identifying insecticide types and how to use it, followed by categorization games for students, and direct practice to make an ovitrap. The results showed an increase in knowledge of the kindergarten students and their companions. Health education through music and direct practice of making an ovitrap can increase kindergarten students’ knowledge of dengue disease, especially aedes breeding place and correct use of insecticides to avoid insecticide resistance.

The Utilization of Moringa Leaves (Moringa Oleifera) as a Nutritional Supplement in Preventing Stunting in Toddlers: Nutrition Study and the Impact of Routine

Oktaviani Cahyaningsih, Okti Trihastuti Dyah Retnaningrum, Chusnul Zulaika — Thu, 02 Jan 2025 00:00:00 +0700

The issue of stunting is a shared challenge. Globally, based on data from the United Nations Children's Fund (UNICEF) and the World Health Organization (WHO), Indonesia ranks 27th out of 154 countries with stunting data, placing it 5th among countries in Asia. The stunting rate in Indonesia is still far from the target reduction of 14 percent by 2024. According to the 2023 Indonesian Health Survey (SKI), the national prevalence of stunting is 21.5 percent, a decrease of about 0.8 percent compared to the previous year. The problem of stunting could pose a challenge for Indonesia's Golden 2045. Consuming moringa leaves (Moringa Oleifera) is one alternative to address the nutritional issues present in Indonesia. This plant has super nutritional content, beneficial for food and medicine. This study aims to evaluate the potential of using Moringa leaves as a nutritional supplement for toddlers in preventing stunting, and to determine whether there are differences in toddlers before and after being given food with added Moringa leaves. This research uses a Quasi-Experimental research design, employing quantitative data analysis, specifically a one group pretest post test design. Sample of 30 respondents. There was an increase in body weight before and after the administration of moringa leaves, amounting to 2.01 kg, while for height, there was an increase of 1.3 cm before and after the administration of moringa leaves. There is a difference between the measurements taken before the addition of moringa leaves to the diet and those taken after. After the addition of moringa leaves to the diet, there was a positive outcome, with 30 respondents experiencing weight gain. Additionally, there was a difference in height measurements before and after the addition of moringa leaves to the diet. The conclusion of this study is that there is an increase in both body weight and height after the addition of moringa leaves to the diet.

Early Detection Of Prediabetic and Risk Factors in Tomohon City High School Students

Thu, 09 Jan 2025 00:00:00 +0700

Diabetes Mellitus (DM) is a degenerative disease that is difficult to control, especially in this era due to lifestyle changes. DM is not only affected by adults but also increases in children and adolescents. DM is the cause of many severe complications, such as blindness, heart disease, kidney failure, and various infectious diseases that ultimately lead to premature death. Indonesia is among the top ten countries in the world, with a high prevalence of type 2 DM (T2DM) of 10.7 million cases. The 2018 Riset Kesehatan Dasar (Riskesdas) showed that the incidence of T2DM in Indonesia was 2%, in North Sulawesi 3%, and for ages 15-24 years 0.1%. The results of the same study in adolescents aged 15-24 years who experienced impaired fasting blood glucose (FBS) were 10.7%, and impaired glucose tolerance was 16.8%. High impaired blood glucose levels are an early sign of prediabetes in adolescents. This study aimed to determine and detect prediabetes in high school students in Tomohon City and the risk factors associated with prediabetes, including overweight and obesity, lack of physical activity, smoking, habits of consuming sweetened beverages, and family history. This study used a case-control design, with a sample of 17 high schools in Tomohon City, with a total of 5,461 students in grades X-XII. The sample was divided into two groups: a case group and a control group at a ratio of 1:3. The results of the study found that 25% of students experienced prediabetes, with three related risk factors: obesity and overweight (18.7%), lack of physical activity (4.7%), and habits of consuming sweetened beverages (19.6%). The dominant risk factor is based on the results; cooperation from various parties is expected to control students' lifestyles so that pre-diabetes will not develop into T2DM in the future.

Sedentary Lifestyle of Physiotherapy Students at Universitas Muhammadiyah Lamongan

Dimas Arya Nugraha, Widya Hary Cahyati, Oktia Woro Kasmini Handayani — Tue, 21 Jan 2025 00:00:00 +0700

A sedentary lifestyle involves long periods of sitting or engaging in low-energy activities, such as watching TV, playing video games, using computers, watching online videos, or other electronic media. This type of lifestyle is common in today's modern society and is associated with minimal physical activity, equivalent to 1-1.5 metabolic equivalents (METs). Reduced physical activity among adolescents can have serious health consequences, including obesity, diabetes, musculoskeletal disorders, and decreased physical fitness. This study utilized descriptive quantitative research. The respondents were 32 Physiotherapy students at Universitas Muhammadiyah Lamongan. The results showed that the study found that the level of physical activity among UMLA Physiotherapy students was as follows: 43.75% had moderate physical activity, 31.25% had high-level physical activity, and 25% had low-level physical activity. We can conclude that the majority of UMLA physiotherapy students engage in moderate physical activity, accounting for 43.75% of the respondents. On average, the physical activity of UMLA physiotherapy students does not meet the threshold value for METs.