Prosiding Seminar Nasional Kesehatan https://proceeding.unnes.ac.id/snk <p>QRCBN 62-6861-7047-712 | ISBN 978-602-285-568-2</p> en-US Fri, 07 Nov 2025 00:00:00 +0700 OJS 3.3.0.13 http://blogs.law.harvard.edu/tech/rss 60 EFEKTIVITAS STIMULASI OROMOTORIK DALAM MENINGKATKAN KEMAMPUAN MAKAN DAN STATUS GIZI ANAK: SEBUAH TINJAUAN LITERATUR SISTEMATIS https://proceeding.unnes.ac.id/snk/article/view/4909 <p>Abstract. This systematic literature review examines the effectiveness of oral motor stimulation in improving feeding skills and nutritional status among infants and young children. Seven eligible studies published between 2014 and 2024 were analyzed, including randomized controlled trials and cohort studies with a total sample exceeding 6,000 participants. Results consistently demonstrated that structured oral motor interventions, such as the Premature Infant Oral Motor Intervention (PIOMI) and Oral Motor Facilitation Technique (OMFT), significantly enhanced oral motor coordination, feeding readiness, and chewing–swallowing efficiency (p&lt;0.001). The interventions reduced transition time to full oral feeding by an average of 2.6 days and improved Neonatal Oral Motor Assessment Scale (NOMAS) scores. Long-term effects were observed in improved anthropometric indices, including weight-for-age and height-for-age Z-scores (+0.21–0.32 SD; p&lt;0.05). Integrating oral motor stimulation with responsive feeding and nutritional education further strengthened cognitive and language outcomes in early childhood. The overall probability of intervention success ranged from 85–95%, with large effect sizes (Cohen’s d≈2.8). These findings confirm that oral motor stimulation is a physiologically grounded, safe, and scalable approach that should be incorporated into stunting prevention and pediatric feeding management programs to achieve sustainable improvements in child growth and development.</p> Fitria Hayu Palupi, Oktia Woro Kasmini Handayani, Mardiana Mardiana Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4909 Fri, 07 Nov 2025 00:00:00 +0700 PEMANFAATAN FINDRISC SEBAGAI ALAT SKRINING DINI RISIKO DIABETES MELLITUS PADA REMAJA https://proceeding.unnes.ac.id/snk/article/view/4910 <p>Type 2 diabetes mellitus (T2DM) is increasingly found in young people, this occurs due to changes in modern lifestyles, increased consumption of high-calorie foods, and lack of physical activity. Early detection of risk factors is an important step to prevent the transition from pre-diabetes to T2DM. The Finnish Diabetes Risk Score (FINDRISC) is a simple, non invasive, and economical screening tool that can estimate the risk of DM in the next 10 years. The purpose of this study was to assess the use of FINDRISC as an early screening tool to identify the risk of T2DM in adolescents. The method used a descriptive analytical design with a cross-sectional approach. The sample consisted of 153 adolescents aged 15–19 years selected by stratified random sampling. The instrument used the FINDRISC questionnaire. Data analysis used the chi-square test and multiple logistic regression. The results showed that a total of 106 adolescents (69%) had a low risk, 42 adolescents (27.5%) had a slightly increased risk, and 5 adolescents (3.5%) had a moderate risk. Family history is the most dominant factor influencing the risk of developing diabetes, with adolescents with a family history of diabetes having a 16-fold increased risk (OR=16.89). The study concluded that FINDRISC has proven useful as an early screening tool for T2DM risk in adolescents. Implementing routine screening in adolescents can facilitate early detection and prevention of diabetes through healthy lifestyle education from a young age.</p> Ahmad Baequny, Ari Yuniastuti, Irwan Budiono, Evi Widowati, Sri Hidayati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4910 Fri, 07 Nov 2025 00:00:00 +0700 SYSTEMATIC REVIEW: GIZI DAN PSIKOSOSIAL MEMBENTUK IKATAN IBU DAN JANIN https://proceeding.unnes.ac.id/snk/article/view/4911 <p>Background: Maternalnfetal attachment is a psychological construct that influences maternal health and pregnancy outcomes. Evidence indicates that nutritional status, partner support, and antenatal mental health contribute to this bond; however, findings remain dispersed without synthesis. This study aims to identify and analyze nutritional and psychosocial factors associated with maternalnfetal attachment. Methods: A systematic review was conducted following Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Articles were searched in PubMed, Scopus, and ScienceDirect using keywords maternal–fetal attachment, nutrition, psychosocial, and pregnancy. Studies published from 2015 to 2025 were selected using inclusion and exclusion criteria and appraised with the Joanna Briggs Institute Critical Appraisal Tool. Data were extracted and narratively synthesized by similarities in variables and outcomes. Results: Most reported that micronutrient intake, partner support, positive emotion regulation, and lower antenatal anxiety were significantly associated with higher maternal–fetal attachment scores. Multicomponent interventions combining nutritional strategies with psychosocial counseling demonstrated stronger effects than single-component approaches. Conclusion: Nutritional and psychosocial factors play a pivotal role in shaping maternal–fetal attachment. Strengthening the integration of nutrition-focused care and structured emotional support within antenatal services is warranted to holistically enhance maternal and fetal health.</p> Ana Rofika, Heny Setiyawati, Sri Ratna Rahayu, Sofwan Indarjo Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4911 Fri, 07 Nov 2025 00:00:00 +0700 Analisis Bibliometrik Terhadap Tren dan Arah Perkembangan Penelitian Pimpinella alpina Molk. (Purwoceng) dalam Basis Data Scopus Periode 2012–2025 https://proceeding.unnes.ac.id/snk/article/view/4913 <p>Background: Pimpinella molk or commonly known as Purwoceng, is an endemic plant of Indonesia that has long been used in traditional medicine for its aphrodisiac, adaptogenic, and antioxidant effects. Although the number of scientific publications related to this plant has increased in the last decade, there has been no comprehensive bibliometric study mapping global research trends. Objective: To analyze publication trends, institutional collaborations, and key research topics related to Purwoceng indexed in the Scopus database during the period 2012–2025. Methods: Data were obtained from Scopus using the keywords “Purwoceng,” “Pimpinella molk,” and “Pimpinella pruatjan”. Data were analyzed using VOSviewer software and the Bibliometrix package (R Studio) for bibliometric mapping and collaboration network visualization. Results: There were 17 relevant publications, dominated by institutions in Indonesia. The peak publications occurred in 2016, 2018, and 2021. Keyword analysis identified three main clusters: animal-based preclinical studies, hormonal effects and oxidative stress, and therapeutic potential. Overlay visualization shows a shift in focus from animal studies to molecular exploration and clinical applications. Conclusion: Purwoceng research is still centered in Indonesia with a multidisciplinary scope but is not yet consistent globally. The potential for international collaboration and exploration of clinical studies is wide open for the development of broader therapeutic applications.</p> Anies Setiowati, Oktia Woro Kasmini Handayani, Setya Rahayu Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4913 Fri, 07 Nov 2025 00:00:00 +0700 Peran Kualitas Tidur dalam Meningkatkan Efektivitas Produksi ASI Pada Ibu Menyusui Di Kabupaten Lamongan https://proceeding.unnes.ac.id/snk/article/view/4914 <p>Background: Breast milk production is influenced by hormonal balance and the mother's physical condition. Sleep disturbances during the postpartum period can reduce the secretion of the hormones prolactin and oxytocin, which play a crucial role in lactation. During breastfeeding, mothers often experience disturbed sleep due to frequent nighttime feedings, infant crying, and adjustments to new roles. This study aims to determine the relationship between breastfeeding mothers' sleep quality and breast milk production. Methods: This study used an observational analytical design with a cross-sectional approach. Data were collected using the Pittsburgh Sleep Quality Index (PSQI) questionnaire to assess sleep quality and observation sheets to assess breast milk production. Analysis was performed using the Chi-Square test with a significance level of p &lt; 0.05. Due to the presence of cells with an expected count &lt; 5, an alternative Fisher's Exact Test was used. Results: The results showed that the majority of breastfeeding mothers had good sleep quality (69.1%) and smooth breast milk production (64.3%). There was a significant relationship between sleep quality and breast milk production (p = 0.005; OR = 8.625), meaning mothers with good sleep quality were 8.6 times more likely to have a smooth breast milk supply. Conclusion: Sleep quality is significantly associated with breast milk production. Improving maternal rest management needs to be a priority for healthcare professionals as a promotive intervention in midwifery care.</p> Andri Tri Kusumaningrum, Bambang Budi Raharjo, Widya Hary Cahyati, Sofwan Indarjo Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4914 Fri, 07 Nov 2025 00:00:00 +0700 PEMETAAN INTERVENSI BERBASIS MASYARAKAT DALAM PENCEGAHAN OBESITAS PADA REMAJA: SCOPING REVIEW https://proceeding.unnes.ac.id/snk/article/view/4915 <p>Background: The rising prevalence of adolescent obesity has become a complex global public health challenge. Community- and school-based interventions have been recognized as strategic approaches in preventing adolescent obesity. This study aims to map the types of community interventions implemented globally, classify their approaches, the actors implementing them, and their duration, and identify gaps and opportunities for developing future interventions.Methods: A scoping review was conducted using a descriptive observational approach. Literature searches were performed through the Scopus database up to October 15, 2025, applying the PCC (Population, Concept, Context) framework and PRISMA-ScR guidelines. Articles that met the inclusion criteria were systematically analyzed and entered into a data extraction table. Results: Eight articles from various countries were analyzed, demonstrating that multi-component interventions incorporating health education, physical activity, family engagement, and the creation of supportive environments were effective in reducing body mass index and promoting healthy behaviors. Interventions lasting more than one year demonstrated more stable impacts. Conclusion: This review concludes that cross-sectoral and community-based approaches hold great potential in preventing adolescent obesity. However, active youth engagement, digital technology integration, and evaluation of psychosocial aspects remain gaps that need to be addressed in developing more adaptive and sustainable interventions.</p> Andy Muharry, Haryono Haryono, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4915 Fri, 07 Nov 2025 00:00:00 +0700 PERAN KADER KESEHATAN DALAM PENGENDALIAN HIPERTENSI PADA KELOMPOK RENTAN: SYSTEMATIC LITERATUR REVIEW https://proceeding.unnes.ac.id/snk/article/view/4916 <p>Background: Hypertension is a serious medical condition, often going unnoticed by those affected. It can lead to numerous health complications and even sudden death. Community Health Workers (CHWs) play a pivotal role in managing hypertension among vulnerable population who face barriers to accessing health care facilities. This study aims to examine the role of CHWs in hypertension management among these vulnerable groups. Methods: A systematic literature review was conducted. Data were gathered through a search of Pubmed and Scopus online database. The inclusion criteria were studies involving interventions by CHWs fot individual with hypertension (SBP &gt; 140 mmHg and/or DBP &gt; 90 mmHg), who had no comorbidities and were not pregnant. Results: Seven articles were selected (two RCTs, five cRCTs), all of which were set in rural or peri-urban areas. The study populations in the selected articles were individuals from socioeconomically disadvantaged backgrounds who were assisted by CHWs in utilizing healthcare services to manage their hypertension. Conclusion: CHWs contribute significantly to hypertension management by providing health education, conducting blood pressure monitoring, and offering medication adherence reminders.</p> Ani Susiani, Oktia Woro Kasmini Handayani, Ari Yuniastuti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4916 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN KONDISI PERUMAHAN DENGAN RISIKO PENULARAN TUBERKULOSIS PARU DI WILAYAH PUSKESMAS LARANGAN KOTA CIREBON https://proceeding.unnes.ac.id/snk/article/view/4917 <p>Background : Pulmonary tuberculosis (TB) continues to pose a significant public health problem in Indonesia, with household environmental factors influencing disease transmission. This study aimed to examine the association between housing conditions and pulmonary TB risk in the working area of the Larangan Health Center, Cirebon City. Methods : A case-control design was employed, including 36 smear-positive TB cases and 36 controls selected from neighboring households using purposive sampling. Data were collected through direct observation and measurement of ventilation, lighting, air humidity, occupancy density, wall and floor materials, and ceiling condition, using standardized instruments. Univariate, bivariate (Chi-square), and multivariate (binary logistic regression) analyses were performed. Results : Results indicated that poor ventilation and high occupancy density were significantly associated with increased TB risk, with adjusted odds ratios of 4.30 (95% CI: 1.50–12.20) and 3.60 (95% CI: 1.30–10.10), respectively. Other housing factors were not significant in the multivariate model. Conclusion : The findings emphasize the importance of improving household ventilation, reducing overcrowding, and integrating environmental interventions into TB control programs. Public health strategies combining housing modifications and community education are recommended to mitigate pulmonary TB transmission in high-risk areas.</p> Lili Amaliah, Hanifah Hanifah, Sri Nurcahyati, Oktia Woro Kasmini Handayani, Intan Zainafree Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4917 Fri, 07 Nov 2025 00:00:00 +0700 PENGARUH TERAPI SENTUHAN MENGGUNAKAN TEKNIK TAKTIL KINESTETIK TERHADAP TANDA-TANDA VITAL DAN BERAT BADAN PADA BAYI PREMATUR https://proceeding.unnes.ac.id/snk/article/view/4918 <p>Background: Premature neonates often face physiological problems such as unstable vital signs and low birth weight, which can increase the risk of morbidity and mortality. This study aims to analyse the effect of kinesthetic tactile touch therapy on the vital signs and birth weight of premature neonates at Dr Soekardjo Regional General Hospital in March 2025. Method: The study used a quasi-experimental design with pre-test and post-test in two groups, namely the intervention group (n=11), which received kinesthetic tactile touch therapy and the control group (n=11), which did not receive the intervention. Results: Univariate results showed a uniform distribution of respondent characteristics between the two groups, including gender, infant age, gestational age, and birth weight. Bivariate analysis using paired t-test and independent t-test revealed that the intervention group experienced significant improvements in body temperature, respiratory rate, heart rate, and oxygen saturation after the intervention (p&lt;0.05), while changes in body weight were not significant. The control group also showed changes, but the increase was lower than the intervention group. Conclusion: These results confirm that tactile-kinesthetic touch therapy is effective in improving the physiological stability of preterm neonates. This study recommends the routine implementation of tactile-kinesthetic touch therapy in neonatal care units, as well as further research with larger sample sizes and long-term monitoring to assess the effects on infant growth and development.</p> Ayu Yuliani Sekriptini, Syahidah Zakiya Nurul Aqila, Lia Herliana, Oktia Woro Kasmini Handayani, Haryono Haryono Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4918 Fri, 07 Nov 2025 00:00:00 +0700 PERAN BUKU KIA DALAM MENINGKATKAN PENGETAHUAN IBU TENTANG ASI EKSKLUSIF: STUDI KORELASI DI KOTA MAGELANG https://proceeding.unnes.ac.id/snk/article/view/4919 <p>Background: Breast milk is the main food given to babies that cannot be replaced with any food. In Indonesia, the Ministry of Health (Kemenkes RI, 2018) recommends exclusive breastfeeding as a priority for the national nutrition program, but breastfeeding coverage is still low, only reaching 40.1 in 2021 (Ministry of Health of the Republic of Indonesia, 2022a). Magelang City ranks first with the lowest breastfeeding coverage at 35.5% (Magelang City DKK Profile), 2022). One of the important factors that can affect the success of breastfeeding is the level of knowledge and readiness of mothers, there are still many mothers who have not made the most of the maternal and child book, both due to limited understanding and lack of assistance from health workers which has an impact on the low coverage of breastfeeding in Magelang City. Methods: The study used a correlational quantitative design with a cross-sectional approach. A sample of 44 mothers under five was taken using the purposive sampling technique. Data was collected using a questionnaire and analyzed with the Chi-Square test. Results: A total of 25 respondents (56.8%) have not used the maternal and child book. Meanwhile, most of the mother's knowledge is 23 people (52.3%) who have a sufficient level of knowledge. The results of the Chi-Square test showed a significant relationship between the use of the maternal and child book and the mother's knowledge of breastfeeding (p = 0.000). Conclution: There is a significant relationship between the use of the maternal and child book and the mother's knowledge about breastfeeding.</p> Heni Setyowati, Haryono Haryono, Oktia Woro Kasmini Handayani, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4919 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN POLA MAKAN DAN AKTIVITAS FISIK DENGAN KEJADIAN HIPERTENSI WANITA USIA SUBUR https://proceeding.unnes.ac.id/snk/article/view/4920 <p>Background: Hypertension constitutes a pressing global health challenge, particularly among Women of Childbearing Age (WCA), due to its implications for increased risk of preeclampsia and long-term cardiovascular morbidity. This study aimed to analyze the relationship between dietary patterns (sodium and fat intake) and physical activity levels with the incidence of hypertension in WCA. Methods: This correlational analytic study employed a cross-sectional design, involving 96 WCA respondents (pregnant women and those at risk of pregnancy complications) recruited from five primary healthcare centers (Puskesmas). Primary data were collected through structured interviews using the Food Frequency Questionnaire (FFQ) for dietary assessment and the International Physical Activity Questionnaire (IPAQ) for physical activity levels. Bivariate analysis was utilized for statistical testing. Results: The prevalence of hypertension was exceptionally high, reaching 79.2% in the WCA population studied. Risk analysis revealed that the majority of respondents exhibited high-risk consumption patterns for sodium (65.6%) and fat (58.3%), coupled with a dominant profile of Light physical activity (58.3%). Statistical tests confirmed a significant association between high-risk sodium intake (p&lt;0.05), high-risk fat intake (p=0.001), and low physical activity (p=0.003) with the incidence of hypertension. The proportion of hypertensive subjects was markedly high in the high-risk fat intake group (92.9%) and the light physical activity group (89.3%). Conclusion: A strong and significant relationship exists between high sodium and fat consumption patterns, along with a sedentary lifestyle, and an increased risk of hypertension in WCA. Public health interventions must be focused on behavioral education for low-salt and low-fat diets, alongside the promotion of integrated physical activity, as a crucial primary prevention strategy.</p> Liliek Pratiwi, Siti Harnina Bintari, Dina Nur Anggraini Ningrum, Chatila Maharani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4920 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN TINGKAT PENGETAHUAN DAN SIKAP IBU TENTANG STIMULASI TUMBUH KEMBANG DENGAN STATUS GIZI BADUTA BERISIKO STUNTING https://proceeding.unnes.ac.id/snk/article/view/4921 <p>Background: Stunting remains a chronic nutritional problem in Indonesia, with ongoing challenges in improving child nutrition, particularly related to maternal knowledge and attitudes. Few studies have specifically examined the relationship between mothers’ knowledge and attitudes and the nutritional status (HAZ, WHZ, WAZ) of children under two years old at risk of stunting. Therefore, this study aimed to determine the relationship between maternal knowledge and attitudes and the nutritional status of children under two years at risk of stunting. Methods: This quantitative study used a cross-sectional design involving 34 respondents selected through total sampling. Data were collected through interviews using questionnaires and anthropometric measurements and analyzed using the Spearman Correlation Test. Results: The correlation test showed a significant relationship between maternal knowledge and children’s nutritional status based on height-for-age (HAZ) (p = 0.016), but no significant relationship with weight-for-age (WAZ) (p = 0.442) or weight-for-height (WHZ) (p = 0.614). Maternal attitudes were significantly associated with HAZ (p = 0.017) and WAZ (p = 0.005), but not with WHZ (p = 0.811). Conclusion: Maternal knowledge and attitudes play an important role in determining children’s nutritional status, particularly in supporting linear growth. Mothers with good knowledge and positive attitudes toward nutrition and stunting prevention tend to have children with better nutritional status, especially in terms of height-for-age and weight-for-age.</p> Mimi Ruspita, Siti Harnina Bintari, RR Sri Ratna Rahayu, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4921 Fri, 07 Nov 2025 00:00:00 +0700 IDENTIFIKASI SALMONELLA SP PADA GULAI AYAM DI RUMAH MAKAN KOTA JAMBI https://proceeding.unnes.ac.id/snk/article/view/4922 <p>Background: Salmonella sp. is a pathogenic bacterium that frequently contaminates animal based food products and is a major cause of food-borne diseases. Improper hygiene during food processing and serving increases the risk of contamination. This study aimed to identify the presence of Salmonella sp. in chicken curry (gulai ayam) sold at restaurants in Jambi City. Methods: This descriptive study used a qualitative laboratory approach. Chicken curry samples were collected using a cluster random sampling method from restaurants in each 125 district. Bacterial contamination was examined using the Total Plate Count (TPC) method on Plate Count Agar (PCA). Identification of Salmonella sp. was conducted through Gram staining, culture on Salmonella Shigella Agar (SSA). Results: Of the 63 chicken curry samples analyzed, 13 samples (20.63%) exceeded the bacterial contamination limit (&gt;1×10⁵ CFU/g), and 5 samples (7.94%) tested positive for Salmonella sp. Conclusion: Some chicken curry dishes sold at restaurants in Jambi City were contaminated above microbiological standards and tested positive for Salmonella sp. Strengthening hygiene, sanitation, and routine monitoring of chicken-based food processing is essential to prevent food-borne infections.</p> Maria Estela Karolina, Yemima Dhearni Sidabariba Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4922 Fri, 07 Nov 2025 00:00:00 +0700 FAKTOR PREDIKTOR PRENATAL ANXIETY PADA IBU HAMIL RESIKO TINGGI DI KABUPATEN LAMONGAN https://proceeding.unnes.ac.id/snk/article/view/4923 <p>Background: High-risk pregnancy increases the likelihood of complications for both mother and fetus and is closely linked to psychological problems such as prenatal anxiety. Anxiety during pregnancy can negatively affect maternal health and fetal development through elevated cortisol levels.This study aimed to identify predictors of prenatal anxiety among high risk pregnant women in Lamongan Regency. Methods: Using a correlational analytic design with a cross-sectional approach, 72 high-risk pregnant women from Paciran and Dermo Lemahbang Districts were selected through purposive sampling (KSPR score ≥ 6). Data were collected using demographic questionnaires, the Maternity Social Support Scale (MSSS), and the Depression Anxiety Stress Scale (DASS-14) anxiety subscale. Data were analyzed using Spearman’s Rho and multiple linear regression with a significance level of α = 0.05. Results: Most respondents were aged 20–35 years, multiparous, had high school education, and reported high social support. Maternal age (p = 0.018) and social support (p = 0.012) showed significant associations with prenatal anxiety. Together, both variables explained 14% of the variance (R² = 0.140), with social support as the strongest predictor (p = 0.024). Conclusion: These findings highlight the importance of integrating psychological care and strengthening social support in antenatal services for high-risk pregnancies.</p> Diah Eko Martini, Mahalul Azam, Widya Hari Cahyati, Yuni Wijayanti, Wahyu Retno Gumelar Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4923 Fri, 07 Nov 2025 00:00:00 +0700 FAKTOR-FAKTOR YANG MEMPENGARUHI WAKTU TUNGGU DAN KEPUASAN PASIEN RAWAT JALAN: SYSTEMATIC REVIEW https://proceeding.unnes.ac.id/snk/article/view/4924 <p>Background: Waiting time in hospital services is one of the key indicators of healthcare quality that directly affects patient satisfaction levels. However, many healthcare facilities continue to face challenges related to long waiting times and patient complaints. This study aims to analyze the factors influencing waiting time and patient satisfaction levels in hospital outpatient units. Methods: This study employed a literature review design using the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) approach. Data sources were obtained from Google Scholar, PubMed, and ScienceDirect, covering publications from 2015 to 2024. Results: A total of 171 articles were identified through database searches and manual exploration. After the screening process, 10 articles were finally included in the qualitative synthesis. The review findings indicate that factors influencing waiting time include the number of medical personnel, queuing systems, and administrative efficiency. Meanwhile, patient satisfaction is affected by service speed, staff communication, and facility comfort. Conclusion: Efforts to improve patient satisfaction cannot be separated from comprehensive service system improvements, particularly in waiting time management and staff interaction quality. Therefore, optimizing human resources, implementing technology-based queuing systems, and enhancing facility quality are strategic steps toward achieving effective, efficient, and patient-centered healthcare services.</p> Gladdays Naurah, Intan Zainafree, Chatila Maharani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4924 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS MODEL PENDAMPINGAN UKS DALAM PENCEGAHAN TUBERKULOSIS (TBC) PADA ANAK USIA 12-14 TAHUN, DI KOTA SEMARANG https://proceeding.unnes.ac.id/snk/article/view/4926 <p>Background: Tuberculosis is a chronic infectious disease that is a major global health problem, including in Indonesia. TB prevention efforts in schools require the active role of the school health unit (UKS) as a health education platform to improve children's understanding and take preventive measures. The purpose of this study was to determine the effectiveness of the UKS mentoring model in preventing tuberculosis (TB) in children aged 12-14 years. Methods: This study used a quasi-experimental design with a non-randomized control group pre-posttest, with 40 children aged 12–14 years as respondents. Data were collected through questionnaires and observations, then analyzed using the Wilcoxon Signed Rank Test. Results: The results of the study showed that before the intervention, most of the 40 respondents had sufficient knowledge (57.5%), negative attitudes (60%), negative practices (57.5%), negative motivation (60%), and negative support (60%). After the intervention, there was an increase with good knowledge (90%) and positive attitudes, practices, motivation, and support (100%) in all respondents. Conclusion: There is an educational influence of the UKS mentoring model on increasing the level of knowledge, attitudes, practices, motivation, and support regarding the prevention of TB transmission in children, namely with a significance value of p = 0.000.</p> Tri Wiji Lestari, Ari Yuniastuti, RR Sri Ratna Rahayu, Intan Zainafree Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4926 Fri, 07 Nov 2025 00:00:00 +0700 KUALITAS HIDUP LANSIA PENDERITA DIABETES MELLITUS DITINJAU DARI PENYAKIT PENYERTA OSTEOARTRITIS https://proceeding.unnes.ac.id/snk/article/view/4927 <p>Background: The number of people with Diabetes Mellitus (DM) in Indonesia in 2024 is projected to be 20,426,400, with an adult population of 185,217,400. The prevalence of DM in adults in Indonesia is 11.3%. Assessing quality of life provides insight into the ability to cope with DM. The purpose of this study was to describe the quality of life of elderly people with DM in terms of comorbidities such as osteoarthritis (OA) and the characteristics of DM patients, including age, gender, marital status, occupation, education level, weight, height, BMI, comorbidities, and physical activity. Methods: This was a descriptive study with a cross-sectional survey design. The research instrument was the Osteoarthritis Knee and Hip Quality of Life Questionnaire. Data were collected through interviews with descriptive data analysis. Results: The majority of DM patients at the Integrated Health Post (Posbindu) at the Mangkubumi Community Health Center in Tasikmalaya City had a low quality of life (59.4%). The average age of the elderly at the Posbindu (Integrated Health Post) in the Mangkubumi Community Health Center (Puskesmas) is 66 years, with an average weight of 57 kg and a height of 157 cm. The average BMI is 23.5, categorized as overweight. More than half of those with Diabetes Mellitus (56.2%) suffer from Osteoarthritis. Conclusion: Education on self-management and physical activity is needed to improve the quality of life of people with type 2 Diabetes Mellitus, especially those with DM and Osteoarthritis.</p> Nur Lina, Irwan Budiono, Sri Ratna Rahayu Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4927 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS INTERVENSI DUKUNGAN SOSIAL SEBAGAI UPAYA PENCEGAHAN POSTPARTUM BLUES PADA IBU NIFAS DI WILAYAH KERJA https://proceeding.unnes.ac.id/snk/article/view/4928 <p>Background: The postpartum period is a vulnerable time for psychological disorders, including postpartum blues, baby blues, and postpartum depression. Mood swings in the postpartum period are more common in the first month to one year after delivery. Hormonal changes during pregnancy and drastic childbirth are not the main factors causing these events. Postpartum blues are often caused by fatigue after giving birth, and the perceived lack of support from husbands, family, and other social support is a significant factor in the occurrence of these mood disorders. This study aims to determine the effectiveness of social support interventions as an effort to prevent postpartum blues in postpartum mothers. Methods: The study used a pre-experimental design with a one-group pretest-posttest approach. The population in this study was 85 postpartum mothers in the Karanggeneng Lamongan Community Health Center working area during June-July. The intervention was provided using a psychoeducational approach involving families, especially husbands, through direct communication, emotional support, brief counseling, and education on postpartum care for one week. The final measurement was carried out to determine the postpartum blues score using the Edinburgh Postnatal Depression Scale (EPDS). Results:. There was a significant difference between postpartum blues scores before and after social support intervention. This was demonstrated by the results (Z = −7.322; p &lt; 0.001), with an average decrease from 10.10 ± 1.86 to 7.13 ± 1.43. These results confirm that social support intervention is effective in reducing postpartum blues levels in postpartum mothers. Conclusion: This research has practical benefits, particularly for midwives in the field, to integrate interventions or preventative measures by involving families in services from pregnancy through postpartum through a family-centered care approach. Improved therapeutic communication is also needed to strengthen the effectiveness of emotional support for mothers during the postpartum period.</p> Ponco Indah Arista Sari, Irwan Budiono, Sofwan Indarjo, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4928 Fri, 07 Nov 2025 00:00:00 +0700 STUDI ANALITIK; PERKEMBANGAN ANAK USIA PRASEKOLAH DENGAN STUNTING DI DESA BRANJANG https://proceeding.unnes.ac.id/snk/article/view/4929 <p>The prevalence of short toddlers collected by WHO in 2019 stated that SouthEast Asia is the region with the highest prevalence of stunting (31.9%) in the world after Africa (33.1%). Based on the results of the 2018 Riskesdas, the stunting rate in Indonesia was 30.8%. This figure is still high compared to the National Medium Term Development Plan target of 19% in 2024. The purpose of this study was to analyze the relationship between stunting and development in pre-school aged children in Branjang Village. The design of this research is descriptive correlation with cross sectional approach. The population of this study was 190 children aged 2-5 years. Sampling used purposive sampling method and the number of samples was 65 respondents. The measurement tools used were the Denver Developmental Screening Test II form and a microtoise tool. The statistical test used is the chi-square test. The results showed that 65 respondents were dominated by the age of 2 years (35.4%), female (50.8%), stunted (32.3%), not stunted (67.7%), normal development of 23 (35.4%) and the development of suspects was 21 (32.3%), the chi-square test analysis obtained p-value (0.341) &gt; α (0.05). There is no relationship between stunting and development in preschool-aged children in Branjang Village. Parents are expected to be able to add insight regarding the development of children, especially children who experience stunting so that parents can anticipate developmental delays in children.</p> Trimawati Trimawati, Mona Saparwati, Haryono Haryono, Irwan Budiono, Dina Nur Anggraeni Ningrum Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4929 Fri, 07 Nov 2025 00:00:00 +0700 DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI GEN phtD BAKTERI STREPTOCOCCUS PNEUMONIAE https://proceeding.unnes.ac.id/snk/article/view/4930 <p>Background: Pneumonia remains an infectious disease that is commonly suffered by vulnerable groups, namely children under five years of age and the elderly. Pneumonia is caused by the bacterium Streptococcus pneumoniae. The mortality and morbidity rates of pneumonia infection are very high. S. pneumoniae has a phtD gene that plays a role in host cell adhesion, so it is often associated with bacterial virulence. Its ability to trigger immunity makes phtD a candidate for a vaccine because of its immunogenic properties. The development of specific biomarkers is a priority to improve the quality of laboratory services to prevent and accelerate treatment. Specific primer designs are needed for PCR molecular testing. Methods: This study used a literature review from the NCBI gene bank to obtain the phtD gene sequence of S. pneumoniae bacteria with access number KP127708.1. The gene sequence was analyzed using Primer BLAST, and then each primer obtained was identified according to the criteria for a good primer. Results: From the 10 candidate primers obtained, analyses were conducted on GC content, primer length, and the presence or absence of hairpins and dimers. The results of the analysis with these criteria referred to primer pair number 2. Then, a specificity test was carried out on the S. pneumoniae species, and the gene homology level in the species group in the BLAST test lso showed 100% attachment to that species. Conclusion: forward primer F5 ‘TGGCAGGCAAGTACACAACA3’ and reverse primer R3 ‘GCCTCCGCATCTGCTATCTT5’.</p> Fransisca Probo Setyoningrum, Irwan Budiono, Ari Yuniastuti, Ratna Sri Rahayu Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4930 Fri, 07 Nov 2025 00:00:00 +0700 ANALYSIS BIBLIOMETRIC: PRAKTIK PEMBERIAN MAKANAN PENDAMPING ASI (MP-ASI) PADA BALITA GIZI KURANG USIA 6-24 BULAN https://proceeding.unnes.ac.id/snk/article/view/4931 <p>The practice of providing appropriate complementary feeding is very important to support optimal growth and development, to prevent malnutrition, and reduce the risk of infectious diseases in early childhood. The purpose of this study is to identify publications related to the practice of providing complementary feeding to toddlers aged 6 to 24 months and visualize them. This study uses a bibliometric method using the Scopus database which has been filtered for 874 articles. Analysis and visualization were carried out using VOSViewer, the United States, is a leading country in this field., and the Division of Nutritional Sciences, Cornell University, Ithaca, NY, United States is the organization with the highest publication citation value and the Department of International Health, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD, United States. The highest publication document value has made the most significant academic contribution. Dewey, Kathryn G is the most prolific author who writes about effective interventions to reduce malnutrition. On this topic, four themes were found, namely disease, factors, interventions, and measuring tools.</p> Moch. Soleh, Irwan Budiono, Bambang Budi Raharjo, Dina Nur Anggraini Ningrum Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4931 Fri, 07 Nov 2025 00:00:00 +0700 MAGIC COOL AROMATERAPI LAVENDER TERHADAP PENURUNAN SKALA NYERI DISMENOREA PADA REMAJA PUTRI https://proceeding.unnes.ac.id/snk/article/view/4932 <p>Background: Dysmenorrhea is the most common menstrual disorder experienced by adolescent girls, with approximately 90% suffering from severe pain, and 34% unable to carry out normal daily activities. This condition also triggers emotional fluctuations, tension, and anxiety in 70–90% of adolescents. Non-pharmacological interventions have become a safe and effective alternative for managing menstrual pain, one of which is lavender aromatherapy, known for its natural relaxing and analgesic effects. This study aims to determine the effect of Magic Cool Lavender Aromatherapy on reducing dysmenorrhea pain levels among adolescent girls at SMP Negeri 3 Rajeg. Methods: This research employed a quantitative pre-experimental approach with a one group pre-test and post-test design. The sample consisted of 40 eighth-grade female students experiencing dysmenorrhea. Data analysis was conducted using the Paired Sample T-Test. Results: The results showed a P-value of 0.000 (P &lt; 0.05), indicating a significant effect of lavender aromatherapy on the reduction of pain intensity. The Magic Cool Lavender Aromatherapy was proven effective in alleviating dysmenorrhea pain among adolescent girls. Conclusion: This therapy can serve as an easy, safe, and inexpensive non-pharmacological alternative for managing menstrual pain. It is recommended that adolescents enhance their knowledge of reproductive health and utilize natural therapies to relieve menstrual discomfort.</p> Catur Erty Suksesty, Widya Hary Cahyati, Oktia Woro Kasmini Handayani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4932 Fri, 07 Nov 2025 00:00:00 +0700 PENGARUH EDUKASI DENGAN MEDIA BUKU SAKU DIGITAL TERHADAP PENGETAHUAN IBU NIFAS MENGENAI KESIAPSIAGAAN BENCANA BANJIR DI PUSKESMAS KECAMATAN https://proceeding.unnes.ac.id/snk/article/view/4933 <p>Background: Disaster preparedness is an important aspect in mitigating disaster risk, especially for vulnerable groups such as postpartum mothers. Increasing understanding and knowledge about disaster preparedness can help them reduce risks and ensure the safety of themselves and their babies. Digital pocket book media was chosen as an educational method because of its ease of access and ability to convey information concisely. Objective: This research aims to determine the effect of education using digital pocket book media on the knowledge of postpartum mothers regarding flood disaster preparedness at the Kalideres District Health Center, West Jakarta. Method: The method used in this research is a quantitative method with a pre-experimental one-group pretest-posttest design involving postpartum mothers as samples selected based on inclusion criteria using a total sampling method of 30 respondents. Results: The results of the study showed that there was a significant increase in postpartum mothers' knowledge regarding flood disaster preparedness with an average knowledge score increasing from the sufficient category to the good category after being given an educational intervention with digital pocket book media. Statistical analysis showed a P value &lt;0.001, which indicated a positive effect of education with digital pocket book media. Conclusion: Education using digital pocket book media is effective in increasing postpartum mothers' knowledge about flood disaster preparedness, which is expected to increase community resilience and preparedness in facing disasters. Suggestion: It is hoped that the results of this research can become information material or additional reading references in the STIKes RSPAD Gatot Soebroto library regarding flood disaster preparedness for postpartum mothers.</p> Christin Jayanti, Malia Lianti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4933 Fri, 07 Nov 2025 00:00:00 +0700 DUKUNGAN KELUARGA TERHADAP PENCEGAHAN ANEMIA CALON PENGANTIN WANITA DI KABUPATEN LAMONGAN https://proceeding.unnes.ac.id/snk/article/view/4934 <p>Background: Anemia is a common condition among adolescents, including premarital women. Premarital womens are a vulnerable group and are at risk of developing anemia during pregnancy. Based on the 2018 Basic Health Research, the prevalence of anemia in Indonesia reached 32% among those aged 15-24, indicating that 3 out of 10 adolescents suffer from anemia. The average incidence of anemia among premarital women in the past three years was 6.5%. Family, as the closest group to the premarital women, can help prevent anemia, although not all families understand their role in supporting the premarital women. The purpose of this study was to determine the correlation between family support in the form of emotional support, instrumental support, rewards, and information with anemia prevention behavior. Method: This correlational study involved 275 married women in Sukodadi, Karanggeneng, and Sugio Districts, Lamongan Regency. The sample was selected using purposive sampling. Data were collected using a questionnaire that had been validated. Data were analyzed using the Chi-Square test with α=0.05. Results: The results of the study showed that emotional support (p=0.000), information support (p=0.000), instrumental support (p=0.000), reward support (p=0.000) were correlated with the anemia prevention behavior of premarital womens. Conclusion: Research shows that to improve the behavior of premarital women in preventing anemia, support from the family is needed in the form of emotional support, instruments, information and rewards.</p> Dian Nurafifah, Setya Rahayu, Widya Hary Cahyati, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4934 Fri, 07 Nov 2025 00:00:00 +0700 Eksplorasi Kebutuhan Pasien Diabetes Melitus Tipe-2 terhadap Kemandirian dan Media Informasi untuk Pengembangan Model Edukasi Informasi Berbasis Android https://proceeding.unnes.ac.id/snk/article/view/4935 <p>Background: The prevalence of Type 2 Diabetes Mellitus (T2DM) continues to increase globally and poses a major challenge for healthcare systems. According to the World Health Organization (WHO, 2024), the number of people living with diabetes worldwide is projected to reach 580 million by 2030, while the International Diabetes Federation (IDF, 2023) reports that Indonesia ranks fifth globally with approximately 19.5 million people with diabetes, expected to increase to 28.6 million by 2045. This condition requires innovative and sustainable health education approaches to improve patient self-management. One potential innovation is the use of Android-based educational media as a digital tool to support self-care management among T2DM patients. Objective this study aimed to explore the experiences, needs, and expectations of patients with T2DM, their families, and healthcare professionals toward the development of Android-based educational media to enhance patient self-care independence. Methods: This research employed a qualitative exploratory approach, utilizing in-depth interviews and focus group discussions (FGDs). Participants consisted of ten T2DM patients, two family member, and two healthcare professionals (nurse practitioners and ward heads) from KRMT Wongsonegoro Regional General Hospital, Semarang, Indonesia. Data were collected through semi-structured interviews, direct observations, and document reviews. Data trustworthiness was ensured using source and time triangulation, member checking, and peer debriefing. Thematic analysis followed the six-step framework proposed. The study was conducted from September to October 2025. Results: The analysis revealed ten main themes: (1) perceptions of the disease and early diagnosis experience, (2) need for diabetes information and education, (3) family involvement in patient care, (4) barriers to technology use, (5) preferred forms of educational media, (6) psychological factors and medication adherence, (7) expectations of Android-based educational media, (8) the need for continuous education at home, (9) patients’ socio economic context, and (10) healthcare professionals’ support for digital innovation. The findings indicate that patients expect educational media that are simple, practical, visual audio-based, and supported by family and healthcare providers to improve their self-care behavior. Conclusion: Android-based educational media have strong potential as an effective tool to promote self-care independence among T2DM patients, enhance health literacy, motivation, and ensure continuous education between hospitals and home care. Nurses play a strategic role as digital educators and facilitators of patient self-care, applying Orem’s Self-Care Deficit Nursing Theory within the framework of digital health transformation. Further development of Android-based educational models derived from these thematic findings is recommended for broader implementation in hospital and community nursing settings.</p> Eko Susilo, Oktia Woro Kasmini Handayani, Sri Ratna Rahayu, Intan Zainafree Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4935 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN PENGETAHUAN DAN SIKAP REMAJA PUTRI TERHADAP KEJADIAN INFEKSI SALURAN KEMIH https://proceeding.unnes.ac.id/snk/article/view/4936 <p>Background: Urinary Tract Infection (UTI) is the second most common infection after respiratory tract infections and occurs more frequently in females, especially adolescents and young adults. Final-year nursing students are at higher risk of developing UTIs due to academic stress, the habit of holding urination, inadequate fluid intake, and suboptimal knowledge and attitudes regarding genital hygiene. Purpose: This study aimed to determine the relationship between knowledge and attitudes of female adolescents and the incidence of UTIs. Method: This was a quantitative correlational study using a cross-sectional approach. A total of 79 respondents were selected through proportionate stratified random sampling from a population of 253 third- and fourth-year students in the Diploma and Bachelor of Applied Science programs. Data were collected using Google Form and analysed using the Chi Square test and Fisher’s Exact Test. Result: The results showed no significant relationship between knowledge and UTI incidence (p = 0.198). However, a significant relationship was found between attitude and UTI incidence (p = 0.002), where a positive attitude was associated with a lower risk of developing UTIs. Conclusion: Attitudes of female adolescents significantly affect the incidence of UTIs. Therefore, promoting positive attitudes should be a key component in reproductive health interventions.</p> Elisa Elisa, Lena Belva Talitha, Irwan Budiono, Intan Zainafree, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4936 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN POLA ASUH DAN RIWAYAT PENYAKIT INFEKSI DENGAN STATUS GIZI BADUTA DI PUSKESMAS KEJAJAR I KABUPATEN WONOSOBO https://proceeding.unnes.ac.id/snk/article/view/4937 <p>Latar Belakang: Stunting merupakan masalah gizi kronis yang disebabkan oleh asupan gizi yang kurang dalam waktu cukup lama akibat pemberian makanan yang tidak sesuai dengan kebutuhan gizi. Berdasarkan hasil dari rembug stunting pemerintah kabupaten Wonosobo faktor penyebab stunting yaitu penyakit infeksi, pola asuh yang kurang baik, asupan gizi kurang, ekonomi, infrastruktur dan pengetahuan serta pendidikan ibu yang rendah. Kejadian stunting di wilayah kerja puskesmas dari bulan Januari – Juni 2024,puskesmas Kejajar I menempati urutan kedua kejadian stunting yaitu 34,3%. Penelitian ini bertujuan untuk mengetahui hubungan riwayat penyakit infeksi dan pola asuh dengan status gizi (TB/U) Baduta (Bawah Dua Tahun) di Wilayah Kerja Puskesmas Kejajar I Wonosobo. Metode:Jenis penelitian ini adalah survey analitik dengan pendekatan cross sectional. Populasi adalah ibu Baduta berjumlah 149 orang dan jumlah sampel sebanyak 60 ibu baduta.Instrumen penelitian berupa kuesioner. Dan analisa data menggunakan uji Chi Square. Hasil:Ada hubungan antara riwayat penyakit infeksi (p value=0,000) dan pola asuh (p value=0,000) dengan status gizi (TB/U) Baduta. Simpulan:bahwa terdapat hubungan yang bermakna antara riwayat penyakit infeksi pada anak dan pola asuh oleh orang tua dengan status gizi Baduta (TB/U).Disarankan agar ibu Baduta rajin dalam mengikuti kelas Ibu Balita.</p> Erna Widyastuti, Haryanti Haryanti, Sri Wahyuni, Mahalul Azam, Ari Yuniastuti, Widya Hary Cahyati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4937 Fri, 07 Nov 2025 00:00:00 +0700 PERAN MEDIA DIGITAL TERHADAP PENINGKATAN LITERASI KESEHATAN REPRODUKSI REMAJA: A SYSTEMATIC LITERATURE REVIEW https://proceeding.unnes.ac.id/snk/article/view/4938 <p>Background: Adolescent Reproductive Health Literacy is crucual in the midst of increasing sexual and reproductive health risks. Traditional educational methods are often less successful in reaching adolescents and overcoming social taboos. Digital media (mobile health os mHealth) offers great potential as a provate, engaging, and effective channel. The purpose of this study is to systematically review the role of digital media in improving adolescent reprdoductive health literacy. Methods: This Systematic Literature Review (SLR) based on Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) analyzed seven reputable international journal articles (Scopus, PubMed, ScienceDirect) focusing on the role of digital media interventions on adolescent ARHL. Data were extracted covering Title, Author, Year, Population, Method, Digital Media, and Results. Results: Digital media interventions (SMS, instant messaging apps, Gamification, and AI Chatbots) consistently showed significant results in improving adolescents' ARHL knowledge and positive attitudes (p&lt;0.05). Digital media functions as a safe and non-judgmental space that boosts adolescents' self-efficacy in accessing services. Gamification specifically increased engagement and learning motivation. However, challenges were noted, including extreme gender bias in AI chatbot users and the need for deeper validation of long-term behavioral change. Conclusion: Digital media proves to play a transformative role as a private and interactive channel for enhancing adolescents' cognitive and affective ARHL. Future intervention designs must focus on inclusivity and the integration of clinical support to encourage sustainable behavioral change.</p> Eti Salafas, Haryono Haryono, Irwan Budiono, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4938 Fri, 07 Nov 2025 00:00:00 +0700 TREN PENELITIAN ASI PADA IBU BEKERJA: ANALISIS BIBLIOMETRIK INDONESIA https://proceeding.unnes.ac.id/snk/article/view/4939 <p>Background: Exclusive breastfeeding for the first six months of life is strongly recommended, including for working mothers. However, limited evidence is available on the overall direction and research trends in this field. This study aimed to identify the novelty, trends, research gaps, and Indonesia’s contribution to scientific publications related to exclusive breastfeeding among working mothers. Methods: A bibliometric analysis was conducted using the Scopus database with the keyword syntax: “Breastfeeding” OR “Exclusive Breastfeeding” AND “Workers” OR “Working Mothers” OR “Employees”. The search was limited to research articles published between 2013 and 2023, yielding 561 documents. Data were analyzed and visualized using Biblioshiny (R Studio) and VOSviewer. Results: Publications on breastfeeding among working mothers have shown fluctuating growth over the past decade. The most influential journals were BMC Pregnancy and Childbirth, PLOS One, and Maternal and Child Nutrition. The United States was identified as the most productive country, with the Johns Hopkins Bloomberg School of Public Health as the leading affiliated institution. Dominant research themes included poverty, rural areas, and nutrition, with qualitative methods being most frequently applied. Indonesia contributed significantly and ranked among the top five publishing countries. Conclusion: Research on breastfeeding among working mothers remains underexplored, especially regarding workplace-related factors and strategies to enhance breastfeeding self-efficacy. These areas present promising opportunities for future investigation, particularly in developing countries such as Indonesia.</p> Faizatul Ummah, Oktia Woro Kasmini Handayani, RR Sri Ratna Rahayu, Heny Setyawati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4939 Fri, 07 Nov 2025 00:00:00 +0700 FAKTOR YANG BERHUBUNGAN DENGAN PREEKLAMSIA IBU POSTPARTUM: A SYSTEMATIC LITERATUR REVIEW https://proceeding.unnes.ac.id/snk/article/view/4940 <p>Background: Preeclampsia is a leading cause of maternal and perinatal morbidity and mortality worldwide. Six percent of preeclampsia cases occur after delivery. This systematic review aims to identify and analyze factors associated with postpartum preeclampsia to support early detection and intervention strategies. Methods: This systematic review was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. A comprehensive search was conducted using electronic databases, including Scopus and PubMed, to identify relevant studies published between 2015 and 2025. Results: A total of 725 records were identified, and 8 studies met the inclusion criteria. These findings highlight several factors significantly associated with postpartum preeclampsia, including maternal age &gt;30 years, race, BMI, blood pressure, magnesium sulfate use, and cesarean section. Although early detection and intervention were not directly evaluated in these studies, the identification of these risk factors suggests that targeted screening and supportive strategies may be beneficial in reducing postpartum preeclampsia. Conclusion: This review identifies demographic and clinical factors associated with postpartum preeclampsia. These findings emphasize the importance of early detection and comprehensive postpartum care to reduce risk and improve maternal health outcomes.</p> Elisa Ulfiana, Tandiyo Rahayu, Yuni Wijayanti, Dina Nur Anggraini Ningrum Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4940 Fri, 07 Nov 2025 00:00:00 +0700 ANALISA KUALITAS AIR SUMUR PENDUDUK YANG BERMUKIM DI SEKITAR EKS TEMPAT PEMBUANGAN AKHIR (TPA) SAMPAH TANJUNG KRAMAT KOTA GORONTALO https://proceeding.unnes.ac.id/snk/article/view/4941 <p>Air sumur penduduk di sekitar TPA merupakan sumber air utama bagi masyarakat dan para pemulung. Adanya perubahan kualitas air karena pengaruh air lindi dari TPA jelas akan mempengaruhi pengguna air sumur khususnya bagi kesehatan. Oleh karena itu penting untuk mengkaji pengaruh air lindi tersebut terhadap keberadaan air sumur penduduk atau kualitas air sumur di sekitarnya. Metode yang digunakan dalam penelitian ini adalah analisis deskriptif, dengan membandingkan kualitas air sumur penduduk di sekitar Eks TPA Tanjung Kramat dan Baku Mutu Air Bersih berdasarkan Permenkes Nomor 492/MENKES/PER/IV/2010 tentang Syarat-syarat dan Pengawasan Kualitas Air. Hasil penelitian ini menunjukkan kualitas air sumur penduduk ditinjau dari parameter fisiknya (warna, bau, dan temperatur ) sudah memenuhi baku mutu yang diperbolehkan sedangkan jika dilihat dari kekeruhannya, rata-rata air sumur tersebut agak keruh dengan nilai NTU 35 sampai 75 (tidak sesuai Baku Mutu 25 NTU) dan berasa asin, sehingga tidak digunakan oleh masyarakat untuk dikonsumsi, ditinjau dari parameter kimia, yaitu pH semua air sumur tersebut sudah memenuhi syarat baku mutu yang ditetapkan Permenkes yaitu pH rata-rata 7, dan semua sampel air sumur sudah tidak memenuhi syarat untuk diminum. Nilai Coliform dan E. Coli hasil penelitian semuanya diatas Baku Mutu yaitu 2,4 x 103, 4,6 x 102 dan 9,3 x 10 (Baku Mutu 0,5 x 10 untuk E. Coli dan 0,1 x 10 untuk Coliform) karena tingginya kandungan bakteri koliform, sehingga dalam penggunaannya untuk diminum terlebih dulu harus dimasak.</p> Ekawaty Prasetya, R. Susanti, Eram Tunggul Pawenang, Yuni Wijayanti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4941 Fri, 07 Nov 2025 00:00:00 +0700 THE FACTORS ASSOCIATED WITH LOW BACK PAIN COMPLAINTS AMONG EMPLOYEES OF STIKes CIREBON https://proceeding.unnes.ac.id/snk/article/view/4943 <p>Background: Low back pain (LBP) is one of the occupational diseases that can cause disability, affect work productivity, and reduce well-being. This study aims to determine the factors associated with LBP complaints among employees of STIKes Cirebon. Methods: This research used a quantitative method with a cross-sectional design. The population in this study consisted of all employees of STIKes Cirebon, totaling 115 respondents, with samples taken using accidental sampling techniques. The instrument was a questionnaire administered through interviews. Data analysis was performed using the Chi Square test and logistic regression. Results: The statistical results of the Chi-Square test on sitting duration obtained a p-value of 0.044, which is significant with LBP complaints, while age had a p-value of 0.606, type of work had a p-value of 0.939, and level of physical activity had a p-value of 0.158, which is not significant with LBP complaints. The results of logistic regression showed that there were no significant variables. Conclusion: This study shows that sitting duration is a factor that has a significant relationship with Low back pain (LBP) complaints among the three other factors.</p> Heni Fa’riatul Aeni, Evi Widowati, Oktia Woro Kasmini Handayani, Putri Nadira Khairunnisa Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4943 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS VIDEO EDUKASI KESEHATAN TERHADAP PENGETAHUAN CUCI TANGAN PADA IBU NIFAS SEBELUM MENYUSUI https://proceeding.unnes.ac.id/snk/article/view/4944 <p>Background: Lack of knowledge causes many postpartum mothers to neglect handwashing before breastfeeding their babies. Health education through video media is expected to improve mothers’ understanding of the importance of hand hygiene prior to breastfeeding. This study aimed to determine the effect of health education videos on the level of knowledge regarding handwashing before breastfeeding among postpartum mothers at Muhammadiyah Hospital Kalitidu. Methods: This study employed a pre-experimental design with a one-group pretest–posttest approach. The population consisted of all postpartum mothers in June 2024, using a total sampling technique. Data were collected using questionnaires and analyzed using the Wilcoxon Signed Rank Test. Results: Before the intervention, most respondents (84.1%) had low knowledge levels. After being given the health education video, the majority (93.2%) demonstrated good knowledge levels. Statistical analysis showed a significant result with p = 0.000 and Z = -6.094, indicating that health education videos significantly affected knowledge improvement regarding handwashing before breastfeeding among postpartum mothers at Muhammadiyah Hospital Kalitidu. Conclusion: Health education videos are proven to be an effective method to enhance postpartum mothers’ knowledge of hand hygiene before breastfeeding. Therefore, this medium can be recommended as an engaging and easily understood educational strategy in healthcare settings.</p> Heny Ekawati, Irwan Budiono, Ari Yuniastuti, Widya Hary Cahyati, Wahyu Retno Gumelar, Nita Yusiana Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4944 Fri, 07 Nov 2025 00:00:00 +0700 INTERVENSI EDUKASI DIGITAL TEKNIK MENYUSUI UNTUK MENINGKATKAN EFEKTIVITAS MENYUSUI PADA IBU NIFAS DI PELAYANAN KESEHATAN PRIMER https://proceeding.unnes.ac.id/snk/article/view/4945 <p>Background: The development of digital technology has encouraged innovation in the delivery of health education that is more flexible and interactive. In midwifery practice, digital education on breastfeeding techniques can be an effective strategy to improve mothers' ability to perform correct breastfeeding techniques. This study aims to analyse the effect of digital breastfeeding technique education intervention on breastfeeding effectiveness among postpartum mothers in primary health care services. Methods: The research design used was a one-group pre-test and post-test pre-experimental design involving 60 postpartum mothers selected through purposive sampling. The research instrument used the LATCH observation sheet, which consists of five components: Latch, Audible swallowing, Type of nipple, Comfort, and Hold to assess the effectiveness of breastfeeding techniques. The intervention was carried out by providing digital educational media in the form of interactive videos and digital flipbooks on breastfeeding techniques developed based on the Health Promotion Model (HPM). Data analysis used the Paired Sample T-Test with a significance level of α = 0.05. Results: The results of the study showed a significant increase in all components of the LATCH score after the digital education intervention. The highest increase occurred in latching on and breastfeeding position, followed by comfort and audible swallowing. The average total LATCH score increased from 1.59 ± 0.73 to 2.54 ± 0.50 (p = 0.000 &lt; 0.05) in 56 respondents. These results indicate that digital education on breastfeeding techniques is effective in improving breastfeeding skills and effectiveness in postpartum mothers in primary health care. Conclusion: Digital education on breastfeeding techniques has been proven to have a significant effect on breastfeeding effectiveness in postpartum mothers. An increase in breastfeeding effectiveness was observed after mothers received appropriate digital education on latching and breastfeeding positions. Therefore, the provision of digital education on breastfeeding techniques should be incorporated into routine programmes in primary health care during the postpartum period to support the success of exclusive breastfeeding.</p> Ihda Mauliyah, Ratih Indah Kartikasari, Oktia Woro Kasmini Handayani, Haryono Haryono, Eram Tunggul Pawenang Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4945 Fri, 07 Nov 2025 00:00:00 +0700 SUPLEMENTASI MIKRONUTRIEN UNTUK REDUKSI KECEMASAN DAN NYERI PERSALINAN: SISTEMATIK REVIEW https://proceeding.unnes.ac.id/snk/article/view/4946 <p>Background: Antenatal anxiety is closely linked to labor pain perception through psychoneuroimmune pathways, including HPA axis activation, proinflammatory cytokines, and neurotransmitter modulation, which influence pain threshold and coping during contractions. Nutritional status, particularly essential micronutrient adequacy, has the potential to stabilize the stress response, reduce inflammation, and improve neuromuscular function. Supplementation with omega-3, magnesium, iron, and vitamin D during pregnancy is considered a rational complementary approach to reducing labor anxiety and pain in the primary care setting. Objective: To assess the effectiveness of these four supplementation approaches on maternal anxiety and first-stage pain intensity. Methods: This systematic review followed PRISMA, searching PubMed, Scopus, Web of Science, and Cochrane without language restrictions. Included designs included randomized trials, quasi-experimental studies, and cohorts that reported on anxiety (e.g., HADS-A/STAI) and/or labor pain (VAS/NRS). Risk of bias was assessed using RoB 2 or ROBINS-1; random effects meta-analyses were considered if homogenous. Results: Preliminary evidence suggests omega-3s reduce mild to moderate anxiety; magnesium has the potential to improve neuromuscular tension; iron supplementation reduces anemia factor associated with a lower pain threshold; vitamin D findings are heterogeneous. The quality of evidence varies from low to moderate, limited by sample size, duration, and instrument heterogeneity. Conclusion: Supplementation with certain micronutrients holds promise for reducing antenatal anxiety and possibly labor pain, but standardized randomized trials with adequate sample sizes are needed to strengthen clinical recommendations.</p> Irfana Tri Wijayanti, Tandiyo Rahayu, Sofwan Indarjo, Intan Zainafree Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4946 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS STRATEGI PROMOSI KESEHATAN PADA TINGKAT PENGETAHUAN DAN PARTISIPASI MASYARAKAT DALAM PROGRAM MAKANAN BERGIZI GRATIS: TINJAUAN LITERATUR SISTEMATIS https://proceeding.unnes.ac.id/snk/article/view/4947 <p>Background: The Free Nutritious Meal Program represents a strategic government initiative to enhance Indonesia's human resource quality, yet faces challenges in public understanding and active participation. This study aimed to analyze the effectiveness of health promotion strategies in accelerating cognitive capacity enhancement and community participation in the Free Nutritious Meal Program. Methods: The study employed a Systematic Literature Review design analyzing fifteen published studies. Data collection was conducted through systematic literature search, while data analysis used narrative synthesis methods to identify patterns, themes, and key findings related to health promotion interventions. Results: Educational interventions based on behavior change theory demonstrated significant knowledge improvement regarding balanced nutrition principles among target populations. Self-efficacy, perceived benefits, and self-confidence were identified as determinant predictors of community participation. Implementation challenges included inconsistent funding allocation, food distribution disparities, heterogeneity in nutritional understanding, institutional coordination fragmentation, and weak program quality supervision. Conclusion: Health promotion strategies effectively enhance cognitive capacity and community participation, but require reformulation of multi-stakeholder approaches integrating inclusive communication, local cadre mobilization, digital platforms, cross-sectoral coordination, and information technology-based monitoring systems to ensure program sustainability.</p> Jumriyanti Nasaru, Mahalul Azam, Oktia Woro Kasmini Handayani, Ari Yuniastuti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4947 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN KOMUNIKASI PERAWAT DENGAN COMPLAINT HANDLING DI PUSKESMAS DRADAH LAMONGAN https://proceeding.unnes.ac.id/snk/article/view/4948 <p>Background: Complaint Handling or called with handling complaint is common complaint _ disclosed dissatisfaction or disappointment . Feelings of dissatisfaction by consumer when buy and use goods , good that in the form of product physique or service service . The purpose of this research is to find out connection communication nurse with complaint handling at the Puskesmas Dradah Lamongan. Methods: Research design used is correlation analytic with approach cross sectional, using Simple consecutive Sampling with whole population patient take care stay and partial sample patient take care stay . Independent variable Communication and dependent variable Complaint Handling . The research instrument used a questionnaire . Data analysis using Spearman Rho test . with a significance level of &lt;0.05. Results: The results of this study after being carried out , the data obtained were almost half communication nurse category good (28.0%) and complaint handling (40.0%). Meanwhile, from the statistical test, the significance value of sign = 0.000 ( p &lt;0.05 ) , with the value of r = 0.671 means that there is a relationship communication nurse with complaint handling have level closeness connection strong. Conclusion: High communication between nurses is expected to have a good impact on handling complaint at the Puskesmas. In this case, it is expected to be more capable, more responsive, friendly to patients and to the patient's family in carrying out tasks and stages at the Puskesmas and have responsibility for the success of the Puskesmas in providing maximum complaint handling to the community</p> M. Bakri Priyodwi Atmadji, Bambang Budi Raharjo, Rr. Sri Ratna Rahayu, Chatila Maharani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4948 Fri, 07 Nov 2025 00:00:00 +0700 FAKTOR-FAKTOR YANG BERHUBUNGAN DENGAN PRAKTIK KUNJUNGAN IBU BALITA KE POSYANDU DI KELURAHAN BANTARSARI TAHUN 2025 https://proceeding.unnes.ac.id/snk/article/view/4949 <p>Background: Posyandu as a health facility for monitoring children's growth and development is still not implemented optimally, this is related to the low participation of mothers bringing their toddlers to Posyandu. Bantar Community Health Center is the Community Health Center with the lowest number of visits by babies and toddlers to Posyandu in Tasikmalaya City, where the lowest data is in Bantarsari Village. Objective: To determine the factors related to the practice of visits by mothers of toddlers to Posyandu in Bantarsari Village in 2025. Method: This research is a quantitative study using a cross sectional approach. The population of this study consisted of 70 mother respondents who had toddlers aged 6-59 months at Posyandu Mekarsari and Posyandu Teratai. The sample was selected using total sampling technique. The variables studied include knowledge, attitudes, perceptions, family support and the role of cadres. Results: The research results show that knowledge, attitudes, perceptions, family support , have a relationship with the practice of visiting mothers of toddlers to Posyandu in Bantar Village.</p> Neni Neni, Ari Yuniastuti, Bambang Budi Raharjo Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4949 Fri, 07 Nov 2025 00:00:00 +0700 Hubungan Antara Peers (Teman Sebaya) Terhadap Perilaku Seksual Remaja di Akademi Kebidanan Prima Husada Kota Bogor Tahun 2025 https://proceeding.unnes.ac.id/snk/article/view/4950 <p>Background : Adolescence is a period where there will be a transitional stage physically, behaviorally, knowledge, biologically and emotionally. The prevalence in America shows that around 46,8% of students have had sexual activity (intercource), only 59,1% used condoms. Methods : This study is a descriptive and analytical observation study with a quantitative and cross sectional approach. The population in this study were 2 and 3 year students of the Prima Husada Midwifery Academy with a total of 53 respondents, using accidental sampling. Results : The results of the chi square test obtained a p value = 0,048 (&lt; 0,05), meaning that there is a significant relationship between peers and adolescent sexual behavior. The OR result = 3,654, meaning that adolescents are 3 times at risk of engaging in sexual behavior from peers. Conslusion : Peers influence risky sexual behavior in adolescents at the Prima Husada Midwifery Academy. The influence of these peers risks adolescent behavior towards deviant behavior and will have an impact on the future of adolescents.</p> Rindasari Munir, Mardiana Mardiana, Feddy Setio Pribadi Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4950 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS THERAPY HAND MASSAGE DALAM MENURUNKAN TINGKAT KECEMASAN IBU POSTPARTUM DI RSUD SAYANG CIANJUR https://proceeding.unnes.ac.id/snk/article/view/4951 <p>Anxiety, also referred to as ansietas, is an emotional response characterized by feelings of unease and fear toward an unclear threat, often accompanied by physical symptoms triggered by subjective individual perceptions and influenced by the subconscious. In postpartum mothers, anxiety may lead to negative experiences such as reduced breast milk production, increased risk of postpartum depression, drug dependency, and diminished capacity to perform maternal roles.This study aims to evaluate the effectiveness of hand massage therapy in reducing anxiety among postpartum mothers. The research employed a pre-experimental method with a One Group Pretest-Posttest Design. Conducted from March to May 2025, the study involved a population of 372 postpartum mothers at Sayang Regional Public Hospital, from which 33 respondents were selected through accidental sampling. The frequency distribution analysis covered respondents' age, parity, educational background, occupation, and income. The results indicated that after receiving hand massage therapy, all 33 postpartum mothers (100%) experienced a reduction in anxiety levels. Statistical analysis using a paired t-test revealed a p-value of 0.000. Since the pvalue is less than 0.05, the null hypothesis was rejected, indicating a significant relationship between hand massage therapy and decreased anxiety in postpartum mothers. These findings suggest that hand massage therapy could be considered a viable and effective method for managing anxiety among postpartum mothers.</p> Fina Sancaya Rini, Oktia Woro Kasmini Handayani, Ari Yuniastuti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4951 Fri, 07 Nov 2025 00:00:00 +0700 ANALISIS INDEKS MASA TUBUH, LINGKAR LENGAN ATAS DAN KADAR HEMOGLOBIN TERHADAP PREEKLAMPSIA https://proceeding.unnes.ac.id/snk/article/view/4952 <p>Background: Preeclampsia is a leading cause of maternal and perinatal mortality worldwide. Preeclampsia is an obstetric complication that affects 2-10% of pregnancies worldwide. Preeclampsia is also a leading cause of maternal death in Indonesia. The purpose of this study was to analyze the relationship between body mass index, mid-upper arm circumference, and hemoglobin levels and preeclampsia in pregnant women at the Muhammadiyah Sumberrejo Islamic Hospital in Bojonegoro. Methods: This study was quantitative with a case-control design. The population was all mothers giving birth. The sampling technique used purposive sampling. A sample size of 300 mothers was divided into 150 mothers with preeclampsia and 150 mothers without preeclampsia. Data were collected from February to August 2025, using observation sheets. Secondary data were taken from the mothers' KIA (Mother's Health) books. Data processing used simple logistic regression analysis with a significance level of &lt;0.05 and a 95% CI. Results: The analysis showed that BMI (B=1.793; p=0.000; Exp(B)=6.007) and mid-upper arm circumference (B=1.737; p=0.004; Exp(B)=5.679) significantly influenced preeclampsia. Meanwhile, Hb levels (B=0.316; p=0.323; Exp(B)=1.372) did not significantly influence the incidence of preeclampsia. Conclusion: BMI and mid-upper arm circumference (MIC) significantly influenced the incidence of preeclampsia. Meanwhile, hemoglobin did not significantly influence the incidence of preeclampsia.</p> Lilin Turlina, Mahalul Azam, Widya Hary Cahyati, Feddy Setyo Pribadi Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4952 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS INTERVENSI EDUKASI BERBASIS E-BOOKLET DALAM MENINGKATKAN KUALITAS PERAWATAN DIRI PASIEN CAPD https://proceeding.unnes.ac.id/snk/article/view/4953 <p>Background: Continuous Ambulatory Peritoneal Dialysis (CAPD) is a crucial treatment option for patients with chronic kidney disease in Indonesia. However, the risk of peritonitis due to poor self-care quality remains a major challenge. Conventional education methods are often ineffective, underscoring the need for interactive digital educational media. This study aimed to evaluate the effectiveness of e-booklet-based educational intervention on improving self care quality among CAPD patients. Methods: A one-group pre-test and post-test design was employed with total sampling of CAPD patients at Dr. Moewardi Hospital, Surakarta. Valid (CVI = 0.963; KMO = 0.911) and reliable (Cronbach’s alpha &gt; 0.92) questionnaire instruments comprising 28 items on a 0–3 Likert scale were used. The intervention involved providing CAPD self-care e-booklets over a one-month period. Data were analyzed using the Wilcoxon signed-rank test. Results: There was a significant improvement in the proportion of patients with good self care quality, increasing from 41.9% to 74.2%, and the number of patients in the poor self-care category dropped to 0% post-intervention. Statistical analysis revealed a significant difference (p&lt;.001), with a higher count of positive ranks (17) than negative ranks (14). Conclusion: E-booklet-based educational media significantly enhance the self-care quality of CAPD patients. Recommendation: The e-booklet is recommended as an integral component of routine educational programs to support therapy sustainability and prevent complications.</p> Muhamad Syamsul Arif Setiyo Negoro, R. Susanti, Yuni Wijayanti, Eram Tunggul Pawenang Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4953 Fri, 07 Nov 2025 00:00:00 +0700 MEMBACA “KELUHAN FISIK” DARI GANGGUAN JIWA KASUS PASIEN DENGAN DISFONIA DAN DEPRESI https://proceeding.unnes.ac.id/snk/article/view/4954 <p>Background: Functional dysphonia is a voice disorder without organic abnormalities, often linked to psychological factors, particularly masked depression dominated by somatic symptoms. Physical manifestations such as voice disturbances may represent unrecognized emotional distress. Limited awareness of psychosomatic aspects can result in misdiagnosis and delayed recovery. This study aims to report and analyze functional dysphonia as a somatic manifestation of a moderate depressive episode and evaluate the effectiveness of a multidisciplinary treatment approach. Methods: This literature review explores the relationship between functional dysphonia and depression as a somatic manifestation. Literature was retrieved from PubMed using the keywords “functional dysphonia,” “psychogenic voice disorder,” “depression,” and “somatic symptom of depression.” Publications from 2020 to October 2025 were critically analyzed to identify psychosomatic patterns and effective management strategies. Results: Findings demonstrate a complex interaction between depression, the nervous system, and phonatory function. Chronic stress and sympathetic activation increase laryngeal muscle tension, reduce phonatory efficiency, and aggravate voice disturbance. A multidisciplinary approach combining voice therapy, psychological intervention, and pharmacotherapy significantly improves clinical outcomes. Conclusion: Functional dysphonia may represent a somatic manifestation of masked depression. Comprehensive diagnosis and collaboration among psychiatrists, otolaryngologists, and voice therapists are essential for optimal recovery.</p> Soesmeyka Savitri, Mahalul Azam Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4954 Fri, 07 Nov 2025 00:00:00 +0700 STUDI KORELASI TINGKAT STRES DAN AKTIVITAS FISIK TERHADAP KADAR GULA DARAH PADA PENDERITA DIABETES MELITUS TIPE II DI RSUD KESESI KABUPATEN PEKALONGAN https://proceeding.unnes.ac.id/snk/article/view/4955 <p>Background: Diabetes mellitus is a metabolic disease characterized by elevated blood glucose levels. Several factors contribute to diabetes, including stress, which can stimulate the release of ACTH, which then triggers the adrenal glands to release the hormone cortisol, which in turn increases blood glucose levels. Low physical activity is a risk factor for uncontrolled blood sugar levels in diabetes mellitus patients. Objective: To determine the relationship between stress levels and physical activity with blood sugar levels in diabetes mellitus patients at RSUD Kesesi Pekalongan Methods: This quantitative study used a descriptive correlation method with a cross-sectional study design. A purposive sampling technique was used to select 100 respondents. Stress levels were measured using the DASS-21 questionnaire, physical activity using the valid and reliable IPAQ questionnaire. The Spearman rank test was used to determine the relationship between stress levels and physical activity with blood sugar levels. Results: There was a significant correlation between stress levels and blood sugar levels, with a p-value of 0.0001 and a correlation coefficient of 0.758. For physical activity, the correlation was -0.610 with a p-value of 0.000. Conclusion: There is a correlation between stress levels and physical activity with blood sugar levels in patients with diabetes mellitus at RSUD Kesesi Pekalongan.</p> Mona Saparwati, Trimawati Trimawati, Mahalul Azam, Evi Widowati, Eram Tunggul Pawenang Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4955 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN MOTIVASI, KOMPENSASI, PENGHARGAAN, DAN BEBAN KERJA DENGAN KINERJA PERAWAT https://proceeding.unnes.ac.id/snk/article/view/4956 <p>Quality health services are inseparable from the role of medical and non-medical personnel, including nurses. Nurses are one of the most potential human resources in hospitals in providing health services in hospitals. Therefore, nurses are required to have a good performance based on the nursing care provided to patients. Nurse performance will be a determining factor in shaping the hospital’s image in the community. Factors affecting nurse performance are classified into individual, psychological, and organizational factors. This study aimed to analyze the relationship between motivation, compensation, rewards, and workload with nurse performance. This research used analytic survey with cross-sectional design. The population were nurses at hospital of 153 people. A total of 61 people was selected using simple random sampling. The data were analyzed by using the Chi-Square test. The results showed a relationship between motivation (p=0.000), compensation (p=0.002), reward (p=0.000), and workload (p=0.004) with nurse performance in hospital. Hospital has to adopt policies to improve nurses’ performance such as preparing appropriate reward system and determining suitable workload.</p> Muhamad Ganda Saputra, Bambang Budi Raharjo, Intan Zainafree, Chatila Maharani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4956 Fri, 07 Nov 2025 00:00:00 +0700 PENERAPAN HAND HYGIENE PERAWAT PADA MASA NEW NORMAL https://proceeding.unnes.ac.id/snk/article/view/4957 <p>Background: Infection prevention and control remain among the most critical challenges in healthcare settings. Proper hand hygiene is the frontline strategy for controlling infections. This study aims to identify the implementation of hand hygiene practices among nurses during the new normal period. Method: This research employed a descriptive-analytic design with a cross-sectional approach. The sampling technique used was purposive sampling, involving 137 nurses from a hospital in Temanggung Regency, Central Java. Data were collected through questionnaires and observation sheets, and analyzed using frequency distribution. Results: Hand hygiene compliance was observed at Moment 1 (62%), Moment 2 (87%), Moment 3 (100%), Moment 4 (94%), and Moment 5 (95%), based on the standard benchmark of 100%. Conclusion: The findings indicate that nurses’ hand hygiene implementation falls within the low compliance category. Strengthening adherence to standardized hand hygiene practices is essential to improve service quality and ensure patient safety.</p> Sri Hananto Ponco Nugroho, Widya Hari Cahyati, Feddy Setio Pribadi Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4957 Fri, 07 Nov 2025 00:00:00 +0700 PERAN HIPNOTERAPI DALAM MENINGKATKAN PELUANG KEHAMILAN PADA KASUS INFERTILITAS YANG TIDAK TERJELASKAN: SEBUAH STUDI KASUS https://proceeding.unnes.ac.id/snk/article/view/4958 <p>Background: Unexplained infertility is a challenging medical diagnosis because, although all test results indicate normal conditions, pregnancy does not occur. This prolonged emotional burden creates an unfavorable neuroendocrine state, thereby affecting reproductive function and reducing the chances of conception. This case study aims to comprehensively and deeply analyze the role of hypnotherapy in addressing psychological barriers and enhancing the chances of pregnancy in a woman diagnosed with infertility. Method: The method used is a single-subject case study with a qualitative descriptive approach to explore changes in the subject's psychological and emotional condition. The research subject was a 34 year-old woman who had experienced primary infertility for 9 years and reported high stress levels due to pressure to conceive. The intervention involved 3 hypnotherapy sessions with a therapy interval of 2 4 weeks and a duration of 3-4 hours per session. Results: Stress levels significantly decreased, and the subject successfully achieved pregnancy in the third month post-hypnotherapy, without the use of any additional fertility treatments or medication. Conclusion: This case study provides initial empirical evidence that hypnotherapy can be an effective and non-invasive tool for addressing the psychological components closely related to unexplained infertility, as well as physiologically facilitating mental health issues.</p> Ninik Christiani, Mahalul Azam, Bambang Raharjo, Sri Ratna Rahayu Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4958 Fri, 07 Nov 2025 00:00:00 +0700 OPTIMALISASI ASIR-V UNTUK MENINGKATKAN KUALITAS CITRA MSCT UROLOGI KONTRAS KASUS HIDRONEFROSIS SEBAGAI UPAYA MENGURANGI DOSIS RADIASI https://proceeding.unnes.ac.id/snk/article/view/4959 <p>Background: Hydronephrosis, ureteral obstruction or renal pelvis, can be evaluated using MSCT urography with contrast. High radiation dose is a consideration in MSCT, decreasing the exposure factor is an option but image noise remains a limitation. Adaptive Statistical Iterative Reconstruction (ASIR-V) algorithm can reduce noise, but the optimal ASIR-V level is still debated. This study aims to evaluate the differences in anatomical information among ASIR-V variations and determine the most optimal settings for hydronephrosis. Methods: This experimental study analyzed 30 urological MSCT images generated from 10 patients. Two radiologists assessed the anatomical information, against the application of ASIR-V on images with 50%, 60% and 70% variation. Friedman test followed by Wilcoxon test was used to analyze the differences among ASIR-V levels, with the error rate set at 5%. Results: There were significant differences in the clarity of anatomical information across ASIR-V variations (p=0.004). The highest mean rank (2.75) was observed at ASIR-V 60%, indicating it provided the best anatomical clarity in contrast-enhanced urological MSCT for hydronephrosis.. Conclusion: ASIR-V 60% produces the most optimal anatomical information clarity in contrast-enhanced urological MSCT examinations for clinical hydronephrosis.</p> Rini Indrati, Akbar Alhafiz, Halinda Fatmayanti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4959 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS PEMBERIAN PEPAYA TERHADAP PRODUKSI LAKTASI IBU MENYUSUI STUDI DI WILAYAH PUSKESMAS UNAAHA https://proceeding.unnes.ac.id/snk/article/view/4960 <p>Background: Breast milk (ASI) is the best natural nutrition for infants up to six months of age. However, exclusive breastfeeding coverage in Konawe Regency remains low, particularly in the Unaaha Health Center area, which reached only 47.13%. One contributing factor is delayed milk production during the early postpartum period. Papaya (Carica papaya L.) contains lactagogue compounds such as flavonoids, alkaloids, and vitamins that can stimulate prolactin and oxytocin hormones to enhance milk production. This study aimed to analyze the effectiveness of papaya juice administration on improving breast milk production among breastfeeding mothers in the Unaaha Health Center area. Methods: This study employed a one-group pretest–posttest experimental design with a total sampling of 34 normal postpartum mothers. The intervention involved 100 grams of papaya juice consumed three times daily for seven consecutive days. Data were collected through observation and structured interviews using questionnaires and analyzed using the Paired Sample T-Test at a significance level of α = 0.05. Results: The proportion of mothers with smooth milk flow increased from 26.5% (pretest) to 61.8% (posttest) with p = 0.000 (&lt;0.05). Conclusion: Papaya juice administration effectively enhances breast milk production among breastfeeding mothers and can serve as a locally based nutritional intervention to support the exclusive breastfeeding program in Konawe Regency.</p> Murti Wuryani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4960 Fri, 07 Nov 2025 00:00:00 +0700 PENERAPAN KONSEP GREEN HOSPITAL YANG BERDAMPAK PADA PENINGKATAN KESEHATAN LINGKUNGAN: SYSTEMATIC LITERATURE REVIEW https://proceeding.unnes.ac.id/snk/article/view/4961 <p>Masalah kesehatan lingkungan yang timbul akibat aktivitas pelayanan kesehatan kini menjadi perhatian utama. Oleh karena itu, untuk mendukung pelayanan di rumah sakit dibutuhkan penyehatan lingkungan namun masih membutuhkan perhatian dan perbaikan terkait dengan kebijakan green hospital. Kajian ini bertujuan untuk meninjau secara sistematis literatur ilmiah yang membahas penerapan konsep green hospital yang berdampak pada peningkatan kesehatan lingkungan. Kajian dilakukan dengan mengikuti panduan PRISMA dan menelusuri basis data pubmed, springer dan science direct untuk artikel yang diterbitkan 2020-2025. Dari total 237 artikel yang teridentifikasi, 8 artikel memenuhi kriteria inklusi dan dianalisis lebih lanjut. Hasil dari penelitian ini yaitu penerapan konsep green hospital yang berdampak pada peningkatan kesehatan lingkungan yaitu untuk menciptakan lingkungan yang lebih sehat bagi pasien dan staf melalui desain yang ramah lingkungan, yang dapat mempercepat pemulihan pasien dan meningkatkan produktivitas staf. Dapat disimpulkan konsep ini mencakup efisiensi penggunaan energi dan air, pengelolaan limbah medis dan nonmedis yang sesuai standar, penyediaan ruang hijau, penggunaan material ramah lingkungan, serta penerapan budaya ramah lingkungan oleh seluruh civitas rumah sakit.</p> Irgi Biantara, Oktia Woro Kasmini Handayani, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4961 Fri, 07 Nov 2025 00:00:00 +0700 PENGARUH PIJAT BAYI TERHADAP DURASI MENYUSU PADA BAYI USIA 0-1 BULAN https://proceeding.unnes.ac.id/snk/article/view/4962 <p>Background: Mothers' lack of knowledge about the duration, frequency, and correct method of breastfeeding, lack of family support, and low public awareness of the benefits of exclusive breastfeeding are the causes of low exclusive breastfeeding rates. One way to increase breastfeeding duration is by massaging the baby. This study aims to determine the effect of baby massage on breastfeeding duration in babies aged 0-1 month. Methods: The research is a type of pre-experiment research with a pre test - post test design without using a control group (without control group). Data collection was done by questionnaire. The number of respondents was 32 people with purposive sampling technique. The data obtained were processed statistically using the Chi-Square test and the Wicoxon test. Results: Based on the results of the analysis, it was found that the average value of breastfeeding duration during the post test was 14.06, which was lower than the pre-test average value of 13.28. Wilcoxon test results obtained a significance value of 0.166 (p&gt; 0.05) This indicates that Ha is rejected.</p> Dewi Andariya Ningsih, Nurul Handayani, Eliyawati Eliyawati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4962 Fri, 07 Nov 2025 00:00:00 +0700 PREVALENSI DAN DETERMINAN ANEMIA IBU HAMIL DALAM PERSPEKTIF WILAYAH ADMINISTRATIF https://proceeding.unnes.ac.id/snk/article/view/4963 <p>Anemia in pregnant women remains a significant public health problem in Indonesia, with a fairly high prevalence and disparities between urban and rural areas. This study aims to determine the prevalence of anemia and its determinants, such as age, education, occupation, and parity, among pregnant women in urban and rural areas in Lamongan District. The study used an analytical cross-sectional observational design with a sample of 77 pregnant women who underwent antenatal care (ANC) at the Lamongan and Pucuk Community Health Centers. Data were collected through observation sheets and analyzed bivariately using the chi-square test. The results showed that the prevalence of anemia in rural areas reached 55%, much higher than in urban areas, which was only 2.7%. Education was significantly associated with the incidence of anemia in rural areas (p = 0.005), while other factors did not show a significant association in either area. The average hemoglobin level in the city was 12 g/dL (normal), while in the village it was 10.7 g/dL (lower). It was concluded that anemia in pregnant women was more prevalent in rural areas, with the main determinants being education level and limited access to health services. Region-based interventions are needed to reduce the prevalence of anemia, focusing on nutrition education, iron supplementation, counseling, and improved ANC services.</p> Ratih Indah Kartikasari, Ihda Mauliyah, Irwan Budiono, Haryono Haryono, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4963 Fri, 07 Nov 2025 00:00:00 +0700 MERANCANG PENDIDIKAN SEKSUAL YANG EFEKTIF : SEBUAH SYISTEMATIC REVIEW STUDI INTERVENSI DI BERBAGAI NEGARA https://proceeding.unnes.ac.id/snk/article/view/4964 <p>Background: Sex education plays an essential role in improving adolescent reproductive health and preventing early pregnancy, sexually transmitted infections, and child marriage. Its effectiveness is strongly influenced by social and cultural contexts as well as implementation approaches. Therefore, it is important to identify key elements of successful interventions across various countries to design more effective, contextual, and responsive sex education programs that meet adolescents’ needs. Methods: This study employed a systematic review method to evaluate the effectiveness of sex education interventions among adolescents. Literature was collected from PubMed, Scopus, ScienceDirect, SpringerLink, and Google Scholar databases. From 2,140 articles initially identified, 485 duplicates were removed. After screening titles, abstracts, and full texts, 20 articles met the inclusion criteria and were analyzed based on study location, target population, intervention approach, duration, as well as program outcomes and impacts. Results: Effective sex education programs generally applied a structured, school-based, and participatory approach involving parents and community members. Program success was also influenced by adequate facilitator training and the integration of local cultural values into the curriculum. Conclusion: Effective sex education should be school-based, participatory, evidence-based, and culturally contextualized to enhance adolescents’ knowledge, positive attitudes, and healthy sexual behaviors.</p> Iis Iis, Mahalul Azam, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4964 Fri, 07 Nov 2025 00:00:00 +0700 ANALISIS RISIKO GANGGUAN FUNGSI PARU AKIBAT PAPARAN PESTISIDA PADA PETANI HORTIKULTURA DI KECAMATAN NGABLAK KABUPATEN MAGELANG https://proceeding.unnes.ac.id/snk/article/view/4965 <p>Paparan pestisida bagi petani hortikultura tetap menjadi isu kesehatan lingkungan yang serius di daerah pertanian pegunungan seperti Kecamatan Ngablak, Kabupaten Magelang. Penelitian ini bertujuan untuk mengevaluasi risiko gangguan fungsi paru-paru sebagai akibat dari paparan pestisida dengan mempertimbangkan faktor-faktor seperti lama waktu kerja, masa kerja, frekuensi penyemprotan, penggunaan alat pelindung diri (APD), serta jenis dan dosis pestisida yang diterapkan. Jenis penelitian ini menggunakan desain observasional analitik dengan pendekatan cross sectional, melibatkan para petani penyemprot sayuran di Desa Sumber Rejo. Pengukuran fungsi paru dilaksanakan menggunakan spirometri, sementara data mengenai paparan pestisida dikumpulkan melalui wawancara dan observasi langsung di lapangan. Hasil penelitian penelitian menunjukkan bahwa mayoritas responden menderita gangguan fungsi paru (obstruktif, restriktif, atau campuran). Faktor-faktor yang menunjukkan hubungan signifikan dengan gangguan fungsi paru adalah masa kerja (p &lt; 0,05), frekuensi penyemprotan (p &lt; 0,05), dan ketidaklengkapan penggunaan APD (p &lt; 0,05). Semakin lama seseorang bekerja dan semakin tinggi frekuensi penyemprotan yang dilakukan, semakin besar pula kemungkinan terjadinya gangguan fungsi paru. Kesimpulannya, paparan pestisida memiliki risiko tinggi terhadap penurunan fungsi paru petani sayuran, terutama bagi mereka yang tidak secara konsisten menggunakan APD yang lengkap. Langkah-langkah pencegahan seperti penyuluhan, pengawasan terhadap penggunaan pestisida, dan peningkatan kepatuhan penggunaan APD perlu ditingkatkan untuk melindungi kesehatan para petani.</p> Muhammad Dwian Rahadi, R. Susanti, Yuni Wijayanti, Eram Tunggul Pawenang, Novia Restu Windayani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4965 Fri, 07 Nov 2025 00:00:00 +0700 SYSTEMATIC LITERATURE REVIEW: EFEKTIVITAS EDUKASI DIGITAL INTERAKTIF TERHADAP PENGGUNAAN METODE KONTRASEPSI JANGKA PANJANG https://proceeding.unnes.ac.id/snk/article/view/4966 <p>The use of long-acting reversible contraception (LARC) such as implants and Intrauterine Devices (IUDs) is still relatively low in developing countries, including Indonesia. LARC are more effective and efficient in birth control. The research aims to systematically examine the role of digitalization in increasing the use of MKJP. Electronic database searches using PubMed with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines in June 2025. Relevant studies published between 2015 – 2025 and in English are considered for review. Only relevant articles with the keywords ("reproductive age"[MeSH] OR "men"[MeSH] OR "couples"[MeSH] OR "male" OR "partner") AND ("Intervention") AND ("mobile health" OR "digital health" OR "mobile application" OR counseling OR "health education" OR "website" OR "Mobile" OR "Video" OR "Tablet" OR "computer" OR "PC" OR "Chatbot"[MeSH]) AND ("intrauterine device"[MeSH] OR "contraceptive implant"[MeSH] OR implant) are selected for review. A total of 10 articles were eligible and included in the study review. Results: Digital education audio, video, website, application, mobile-based surveys significantly increased knowledge, positive attitudes, intentions and actions in choosing LARCs. Conclusion: Digital education plays an important role in increasing the use of LARC and a relevant reproductive health intervention strategy in the digital era.</p> Ana Sundari, Siti Harnina Bintari, Dina Nur Anggraini Ningrum, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4966 Fri, 07 Nov 2025 00:00:00 +0700 PENGARUH TERAPI AKTIFITAS KELOMPOK TERHADAP KEMAMPUAN BERORIENTASI PADA PASIEN SKIZOFRENIA DI LAMONGAN https://proceeding.unnes.ac.id/snk/article/view/4967 <p>Background: Schizophrenia is a severe mental disorder often accompanied by impaired reality orientation, hindering patients' independence and quality of life. Pharmacological therapy alone is not optimal in addressing this cognitive deficit, necessitating non pharmacological interventions such as Reality Orientation Group Activity Therapy (TAK). Objective: To analyze the effect of Reality Orientation Group Activity Therapy (TAK) on orientation skills in schizophrenia patients in Lamongan. Methods: This study used a one-group pretest-posttest design with 36 respondents selected through purposive sampling. The Reality Orientation Group Activity Therapy (TAK) intervention was implemented in three structured sessions. Data was collected using observation sheets and analyzed using the McNemar test. Results: Before the intervention, 100% of patients (36) experienced orientation disorders in all aspects (person, place, and time). After the intervention, there was a significant improvement, with 25 patients (69.4%) able to recognize people and time, and 24 patients (66.7%) able to recognize places. The McNemar test results showed a p-value of 0.000 for all sessions, indicating a statistically significant effect. Conclusion: Reality Orientation (TAK) effectively improves the orientation skills of patients with schizophrenia and can be implemented as a complementary therapy in mental health care.</p> Siti Sholikhah, Oktia Woro Kasmini Handayani, Yuni Wijayanti, Eram Tunggul Pawenang Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4967 Fri, 07 Nov 2025 00:00:00 +0700 GAME EDUKATIF UNTUK MENINGKATKAN PENGETAHUAN DAN SIKAP TENTANG PENCEGAHAN HIV/AIDS DI KALANGAN REMAJA : LITERATUR REVIEW https://proceeding.unnes.ac.id/snk/article/view/4968 <p>Background: The spread and transmission of HIV/AIDS among adolescents is closely related to knowledge about the dangers and the process of its spread. The concentration of HIV control programs focused on young age groups is very strategic. Various stu dies have shown the positive impact of play-based learning on adolescents' knowledge, attitudes, and behaviors regarding HIV/AIDS prevention. The main purpose of this systematic review is to find out educational game models that can be developed as health education strategies in an effort to prevent the spread of HIV/AIDS among adolescents. Methods: Literature search was conducted through databased: PubMed, Scopus, and ProQuest, following systematic review writing guidelines. Keywords used for literature review: education, HIV/AIDS, games, with inclusion criteria: topics about educational games, among adolescents, knowledge outcomes, attitudes, behavior change and in the form of experimental research. Results: There were 12,809 articles, then after selection with criteria inclusion, it was found that there were 8 articles that were reviewed. 3 studies were RCT, 2 studies were quasi experimental, utilizing a 2-group pre-test and post-test design, and 3 studies were mixed methods. 4 out of 8 studies evaluated participants' knowledge levels, all of which resulted in increased participants' knowledge after playing educational games. 3 studies revealed a significant positive attitudes. Stigma for HIV/AIDS on adolescent interpreted differently in the literature. Conclusion: It revealed that game educative technology moderately enhances adolescent knowledge, attitudes, and reducing stigma for HIV/AIDS. Further research is essential to enhance game educative HIV/AIDS proficiency effectively.</p> Yani Trihandayani, Oktia Woro Kasmini Handayani, Ari Yuniastuti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4968 Fri, 07 Nov 2025 00:00:00 +0700 FAKTOR GAYA HIDUP DAN PENGOBATAN SEBAGAI DETERMINAN DEPRESI PADA PASIEN DIABETES MELLITUS DI JAWA TIMUR https://proceeding.unnes.ac.id/snk/article/view/4969 <p>Background: Diabetes mellitus (DM) is a common chronic non-communicable disease. High psychological distress in diabetes patients leads to a poor quality of life and is associated with stress and depression. Many factors increase the risk of depression in diabetes patients. This study aimed to analyze the associations of employment status, medication, and physical activity with depression in patients with diabetes mellitus. Methods: The quantitative research design used correlational analysis with a cross-sectional approach. This study used secondary data sourced from the 2023 Indonesian Health Survey (SKI), which included a total of 1,896 people with diabetes mellitus in East Java. The questionnaire consisted of sociodemographic information and assessed depressive disorders using the Mini International Neuropsychiatric Interview (MINI). Data were analyzed using logistic regression. Results: Patients still in school were 5.6 times more likely (OR = 5.632; 95% CI: 1.352 23.471) to experience depression than unemployed patients. Self-employed DM patients also showed a 5.6-fold increased risk with an OR of 5.648 (95% CI: 1.193–26.741). Furthermore, insulin injection treatment increased the odds of developing the condition by 1.75 times (p = 0.027; OR = 1.753; 95% CI: 1.064–2.888), while physical activity had a protective effect, reducing the risk by 57.7% (p = 0.034; OR = 0.423; 95% CI: 0.191–0.936). Conclusion: The results indicate that insulin injections are associated with an increased risk of depression, while physical activity has a protective effect.</p> Abdul Rokhman, Irwan Budiono, Bambang Budi Raharjo, Dina Nur Anggraini Ningrum Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4969 Fri, 07 Nov 2025 00:00:00 +0700 GAMBARAN SEDENTARY LIFESTYLE TERHADAP KESEHATAN FISIK DAN KOGNITIF LANJUT USIA: LITERATURE REVIEW https://proceeding.unnes.ac.id/snk/article/view/4970 <p>Background: In the last decade, sedentary lifestyles have emerged as a new risk factor for health. A sedentary lifestyle is characterised by sitting, leaning and lying down continuously from the moment one wakes up until bedtime. Generally, the elderly have a lot of free time, most of which is spent sedentary, reducing the time available for physical activity. This systematic review aims to provide an overview of the sedentary lifestyle of the elderly in relation to physical and cognitive health. Method: This literature-based systematic review was obtained from NCBI, Scopus, Science Direct, Garuda, Google Scholar, and a total of 12 articles were reviewed to provide an overview of sedentary lifestyles in the elderly. Results: It was found that there was a relationship between a sedentary lifestyle and a lack of physical activity, cognitive function, undesirable physical weakness, higher rates of diabetes, dementia, and even death in the elderly. Conclusion: Therefore, elderly people still need to carry out physical activities that are usually done every day so that the use of elderly people's time is more beneficial, thus shortening the sedentary lifestyle time.</p> Dimas Arya Nugraha, Oktia Woro Kasmini Handayani, Evi Widowati, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4970 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN SANITASI LINGKUNGAN DENGAN KEJADIAN STUNTING PADA BALITA DI PUSKESMAS DRAJAT CIREBON https://proceeding.unnes.ac.id/snk/article/view/4971 <p>Background: Stunting remains a major health problem in Indonesia, influenced by multiple factors including environmental sanitation, maternal education, and socioeconomic status. This study aims to analyze the relationship between environmental sanitation and the incidence of stunting in toddlers at the Public Health Center Drajat Cirebon. Methods: This study used a cross-sectional design, involving 179 children aged 6–59 months selected through simple random sampling from a population of 425 children. Data were collected through structured interviews and field observations. Bivariate analysis used the Chi-square test, and multivariate analysis used binary logistic regression. Results: The prevalence of stunting was 41.3%. Bivariate analysis indicated that unhealthy latrines, recent diarrhea, and low socioeconomic status were significantly associated with stunting (p &lt; 0.05). In multivariate analysis, unhealthy latrines (OR = 2.08; 95% CI 1.09–3.96), recent diarrhea (OR = 2.44; 95% CI 1.11–5.37), low maternal education (adjusted OR = 0.49; 95% CI 0.25–0.96), and low socioeconomic status (OR = 2.24; 95% CI 1.12–4.49) remained significant determinants of stunting. Conclusion: Comprehensive interventions that improve sanitation, promote hygiene, enhance maternal knowledge, and address socioeconomic constraints are recommended to reduce stunting prevalence in the community.</p> Sri Nurcahyati, Nurul Aisyah, Dede Setiawan, Widya Hary Cahyati, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4971 Fri, 07 Nov 2025 00:00:00 +0700 PEMANFAATAN PENDIDIKAN KESEHATAN SEBAGAI INTERVENSI PENCEGAHAN ANEMIA PADA REMAJA PUTRI; STUDI LITERATUR https://proceeding.unnes.ac.id/snk/article/view/4972 <p>Background: The prevalence of anemia in adolescent girls increased from 37.1% to 48.9% in 2018. Women accounted for 27.2% of the cases, and lack of knowledge about anemia and unsupportive attitudes are also contributing factors. Methods: This study used a literature review with the Prisma method for data collection. A search of journals and articles was conducted through Scopus. Five key journals were reviewed and analyzed. Results: There was a significant relationship between knowledge before and after health education. The likelihood of anemia among adolescent girls with poor knowledge was 1.5 times higher than among adolescents with good knowledge. Conclusion: Improved knowledge about anemia among adolescent girls in schools is necessary to create behavioral changes in anemia prevention and to support successful anemia prevention programs.</p> Kadek Primadewi, Ni Komang Intan Prima Asri, Putu Adi Cahya Dewi Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4972 Fri, 07 Nov 2025 00:00:00 +0700 FAKTOR-FAKTOR YANG BERHUBUNGAN DENGAN PERILAKU SEKSUAL BERISIKO PADA REMAJA DI CIREBON https://proceeding.unnes.ac.id/snk/article/view/4973 <p>Background: Adolescence is a phase of physical, mental, and social growth and development. Adolescents face various problems ranging from school achievement issues, social interactions, unhealthy dating behaviors, and so on. This study aims to identify factors related to risky sexual behavior among adolescents in Cirebon. Methods: Quantitative research design with a cross-sectional approach. The sample consisted of 65 adolescents in Cirebon City in 2024. The instrument used was a questionnaire. Data were collected by distributing the questionnaire. Data analysis was performed univariately and bivariately using the chi-square test. Results: There was no relationship between age (p-value 0.687), gender (p-value 0.492), parental role (p-value 0.244), peer role (p-value 0.243), knowledge (p-value 0.492), as well as attitude with risky sexual behavior (p-value 0.228&gt; 0.05), and there was a relationship between the role of religiosity and risky sexual behavior (p-value 0,019 &lt; 0,05). consists of background/problem statement briefly and ended with the objective. Conclusion: There is no relationship between age, gender, religion, parental roles, peer roles, knowledge, attitude, and risky sexual behavior, but there is a relationship between religiosity and risky sexual behavior. It is hoped that schools will hold regular religious activities to increase students' faith and piety.</p> Tonasih Tonasih, RR. Sri Ratna Rahayu, Widya Hary Cahyati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4973 Fri, 07 Nov 2025 00:00:00 +0700 UPAYA MENINGKATKAN KESEHATAN MENTAL MAHASISWA DENGAN MENGEKSPLORASI DIMENSI KESEJAHTERAAN KAMPUS DI KOTA SEMARANG https://proceeding.unnes.ac.id/snk/article/view/4974 <p>The purpose of this study is to develop a concept and dimensions of campus well-being in higher education institutions in Indonesia to improve mental health student collage. The data collection technique used in this study was Focus Group Discussion (FGD) and structured interviews with 30 participants, including students, lecturers, educational staff, and campus leaders. The interview guide was developed based on the school well-being theory by Konu and Rimpela (2002). The results of this study indicate that good campus facilities and services are crucial for enhancing campus well-being. Positive interactions, mutual respect, democratic leadership, and a safe and comfortable campus environment are essential for improving campus well-being. Therefore, it is necessary to improve and develop interactions and relationships between leaders, lecturers, and students to meet the needs of the academic community. Self-development and opportunities for growth are vital for enhancing campus well-being. Physical and mental health are also crucial for improving campus well-being. Other findings include: a comfortable and green campus environment, accessibility and availability of information, reputation and cooperation, and comfort and safety. In conclusion, there are responses related to the 4 indicators of campus well-being, namely having, loving, being, and health, as well as findings on statement items in the aspects of having, being, and loving.</p> Wening Wihartati, Ari Yuniastusti, Irwan Budiono, Yuni Wijayanti Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4974 Fri, 07 Nov 2025 00:00:00 +0700 STRATEGI EFEKTIF PENCEGAHAN OBESITAS ANAK SEKOLAH DASAR: TINJAUAN SISTEMATIS PENDEKATAN SEKOLAH, KELUARGA DAN ANAK https://proceeding.unnes.ac.id/snk/article/view/4975 <p>Childhood obesity among elementary school-aged children is a growing global health issue that affects physical health, mental well-being, and academic development. Preventing obesity requires multi-level interventions targeting various aspects of children’s environments. This study aims to review and evaluate the effectiveness of interventions designed to prevent obesity among elementary school children, focusing on three main approaches: school based, family/parent-based, and child-centered interventions. This research is a systematic literature review conducted by searching relevant studies in the PubMed, ScienceDirect, and Springer Nature Link databases for intervention studies published between 2020 and 2025. Eligible studies included experimental or quasi-experimental research assessing obesity interventions among children aged 6–12 years. A total of 32 articles met the inclusion criteria and were analyzed narratively according to the type of intervention. School-based interventions were found to be effective and comprehensive in reaching child populations, particularly when combining nutrition education, physical activity, and family involvement. Family-based interventions strengthened children’s behavioral changes through emotional support and home environment modifications, while child-centered interventions enhanced motivation and active participation in healthy lifestyles. Approaches integrating all three intervention types demonstrated the most optimal and sustainable outcomes in preventing childhood obesity.</p> Achmad Syaifudin, Nia Supiana, Lutfiyah Rizqulloh, Rr. Catur Leny Wulandari, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4975 Fri, 07 Nov 2025 00:00:00 +0700 EDUKASI KESEHATAN REPRODUKSI BERBASIS DIGITAL UNTUK GENERASI MUDA DI USIA PRODUKTIF; TINJAUAN SISTEMATIK LITERATURE REVIEW https://proceeding.unnes.ac.id/snk/article/view/4976 <p>Background: The low literacy of reproductive health education among young people of productive age in Indonesia leads to a high risk of unplanned pregnancy, early marriage, and reproductive health problems. In the era of the Industrial Revolution 4.0, the digital approach is seen as a potential to expand access and effectiveness of premarital education, although its implementation has not been systematically mapped. This study aims to identify, evaluate, and synthesise scientific evidence on the form, effectiveness, and challenges of digital-based reproductive health education interventions for unmarried productive-age youth. Methods: The review was conducted using the Systematic Literature Review (SLR) method following the PRISMA protocol. Articles were searched through Scopus, PubMed, and ScienceDirect with the keywords ‘preconception education’, “digital”, and ‘youth’ covering publications from 2020-June 2025 in English, full-text, and from reputable journals (Q1-Q3). Results: A synthesis of 24 studies showed that digital interventions, such as educational apps, games, chatbots, and social media, were effective in improving knowledge, attitudes, reproductive health literacy, and communication skills. Most interventions were based on behavioural theory and user-centred design, with high acceptability. Conclusion: Overall, digital interventions have great potential as effective and sustainable premarital education platforms, with recommendations for premarital content integration, multisite research, and cross-sector collaboration to strengthen impact.</p> Murniati Murniati, Oktia Woro Kasmini Handayani, Mardiana Mardiana Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4976 Fri, 07 Nov 2025 00:00:00 +0700 PEMANFAATAN MEDIA SOSIAL : TINJAUAN SISTEMATIK INTERVENSI CEGAH ROKOK DI KALANGAN REMAJA https://proceeding.unnes.ac.id/snk/article/view/4977 <p>Background: Smoking among adolescents is a public health problem that continues to increase in Indonesia. The development of digital technology provides opportunities to develop more relevant prevention strategies, given that adolescents are very familiar with social media and mobile applications. This study aims to identify various digital methods used, evaluate their effectiveness in reducing smoking behavior, and analyze the intervention features that contribute to success. Methods: This study used a Systematic Literature Review (SLR) with PRISMA guidelines. Articles were searched in the Scopus and PubMed databases for publications from 2020 to 2025. Of the 204 articles found, 20 articles met the inclusion criteria and were further analyzed. Results: The results of the study show that digital interventions, such as social media campaigns, web programs, and digital games, are effective in increasing adolescents' knowledge, awareness, and self-efficacy, although the impact on smoking prevalence varies. Social media with gamification and personalization features emerged as the most effective intervention in reaching and influencing adolescent behavior. Conclusion: Digital interventions have great potential as a more effective smoking prevention strategy than conventional methods. Meanwhile, practical implications emphasize the need for interactive, personalized, and socially supported digital programs.</p> Solihin Solihin, Bambang Budi Raharjo, Dina Nur Anggraini Ningrum Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4977 Fri, 07 Nov 2025 00:00:00 +0700 "Efektivitas Model FMF dalam Skrining Preeklampsia Trimester Pertama: Tinjauan Sistematis dan Implikasinya di Indonesia" https://proceeding.unnes.ac.id/snk/article/view/4978 <p>Background Preeclampsia remains one of the leading causes of maternal and perinatal morbidity and mortality worldwide, particularly in low- and middle-income countries. Early detection through first-trimester screening is essential to identify high-risk pregnancies and prevent severe complications. This study aimed to review the effectiveness and development of first-trimester preeclampsia screening models based on global evidence and their applicability to the Indonesian healthcare context. Methods This study was a Systematic Literature Review of 40 international articles published between 2020 and 2025, retrieved from Scopus, PubMed, and ScienceDirect databases. Inclusion criteria consisted of cohort studies and meta-analyses evaluating the performance of the Fetal Medicine Foundation (FMF) screening model and its derivatives. Data were extracted using a standardized form and analyzed thematically and descriptively based on model components, AUC values, and aspirin intervention outcomes. Results The FMF model combining maternal factors, mean arterial pressure (MAP), uterine artery pulsatility index (UtA-PI), and biomarkers PlGF and PAPP-A showed high predictive accuracy (AUC 0.90–0.96; FPR &lt;10%). Low-dose aspirin administered before 16 weeks reduced preterm preeclampsia risk by 55–65%. A simplified three-parameter model remained effective for middle-income populations. Conclusion The FMF model and its adaptations are effective for early preeclampsia screening and can be integrated into Indonesia’s antenatal care system through the 2024 Maternal and Child Health Book and digital KIA programs.</p> Rr. Catur Leny Wulandari, Irwan Budiono, Eram Tunggul Pawenang Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4978 Fri, 07 Nov 2025 00:00:00 +0700 KONTRIBUSI PSIKOSOSIAL SEBAGAI DETERMINAN KEPATUHAN PENGOBATAN PADA PASIEN TB RESISTAN OBAT https://proceeding.unnes.ac.id/snk/article/view/4979 <p>Drug-Resistant Tuberculosis (DR-TB) remains a major public health challenge in Indonesia due to the high rate of treatment failure associated with poor adherence to long-term therapy. Psychosocial support is considered a key determinant in improving patients’ motivation and consistency throughout the treatment process. This study aimed to analyze the effect of psychosocial support on treatment adherence among DR-TB patients. A quantitative analytic study with a cross-sectional design was conducted involving 72 DR-TB patients selected through purposive sampling. Data were collected using validated questionnaires: the Multidimensional Scale of Perceived Social Support (MSPSS) to measure psychosocial support and the Morisky Medication Adherence Scale (MMAS-8) to assess treatment adherence. Statistical analysis was performed using Pearson correlation and simple logistic regression. The results revealed a strong and significant positive correlation between psychosocial support and treatment adherence (r = 0.612; p = 0.000; OR = 3.87). It can be concluded that psychosocial support plays a crucial role in enhancing adherence to DR-TB treatment. This study contributes to the understanding that integrating psychosocial and emotional support interventions into TB control programs is essential to improve long-term treatment success.</p> Awaludin Jahid Abdillah, Heny Setyawati, Widya Hary Cahyati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4979 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN KUALITAS TIDUR DENGAN KADAR GLUKOSA DARAH PADA PENDERITA DIABETES MELLITUS TIPE 2 DI PROLANIS PUSKESMAS PRINGAPUS https://proceeding.unnes.ac.id/snk/article/view/4980 <p>Type 2 Diabetes Mellitus (T2DM) is a metabolic disorder characterized by insulin resistance and impaired insulin secretion. Poor sleep quality contributes to increased blood glucose levels in individuals with T2DM. This study aims to analyze the relationship between sleep quality and blood glucose levels in T2DM patients at Pringapus Public Health Center. This research employs a descriptive-correlational design with a cross-sectional approach. The sample consists of 52 T2DM patients enrolled in the Prolanis program, selected using a total sampling technique. Sleep quality was assessed using the Pittsburgh Sleep Quality Index (PSQI) questionnaire, while random blood glucose levels were measured using an Easy Touch glucometer. Data analysis was conducted using Spearman’s correlation test. The results showed that the majority of respondents (96.2%) had poor sleep quality. The average random blood glucose level was 294.77 mg/dL. Statistical analysis indicated a significant relationship between sleep quality and blood glucose levels (p = 0.001; r = 0.431). In conclusion, poor sleep quality is associated with increased blood glucose levels in T2DM patients. Improving sleep quality may serve as a potential strategy in T2DM management.</p> Nabilah Fadhilatusholikhah Sugiyarto, Rosalina Rosalina, Setya Rahayu, Oktia Woro Kasmini Handayani, Shofwan Indargo Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4980 Fri, 07 Nov 2025 00:00:00 +0700 PENGARUH EDUKASI DENGAN MEDIA AUDIO VISUAL TERHADAP PENGETAHUAN DAN SIKAP MENGENAI BAHAYA MEROKOK DI KALANGAN SISWA SMP NEGERI 2 CISEWU KABUPATEN GARUT https://proceeding.unnes.ac.id/snk/article/view/4981 <p>Smoking behavior among adolescents remains a serious problem because it negatively impacts health and tends to develop into a long-term habit. This study aimed to determine the effect of education using audio-visual media on knowledge and attitudes regarding the dangers of smoking among students of SMP Negeri 2 Cisewu, Garut Regency. The research applied a pre-experimental design with a one group pretest-posttest approach. The population consisted of 96 students from grades VIII and IX, selected using total sampling. The research instruments were knowledge and attitude questionnaires. Data were analyzed using the Wilcoxon Signed Rank Test.The results showed an increase in the mean scores of knowledge and attitudes after the intervention. The Wilcoxon test obtained a significance value of p &lt; 0.05, indicating that education through audio-visual media had a significant effect on improving students’ knowledge and attitudes regarding the dangers of smoking.In conclusion, audio-visual media is effective as a health education tool to enhance knowledge and foster negative attitudes toward smoking behavior among adolescents. This study recommends the utilization of audio-visual media in school-based health promotion programs.</p> Ejeb Ruhyat, Teni Resa Nurrohmah, Irwan Budiono, Sofwan Indarjo, Metha Dwi Tamara Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4981 Fri, 07 Nov 2025 00:00:00 +0700 Sensitivitas Budaya dalam Layanan Kesehatan Reproduksi Remaja: Tinjauan Pustaka Menggunakan Analisis Bibliometrik (VoS Viewers) https://proceeding.unnes.ac.id/snk/article/view/4982 <p>Background: Adolescent reproductive health in Indonesia faces serious challenges due to limited access to services and cultural differences between providers and recipients. This condition reinforces the urgency of a culturally sensitive approach so that health center services can be accepted by adolescents in an inclusive manner. This study aims to map trends, collaboration patterns, and research gaps regarding cultural sensitivity in adolescent reproductive health services through bibliometric analysis. Method: A literature review design with bibliometric analysis using VOSviewer. Data were collected from Scopus, PubMed, Springer Nature Link, Google Scholar, and Dimensions using the keywords “cultural sensitivity, reproductive health, adolescent, service.” Process: identification of 1.249 articles, screening of 252, 125 eligible, 3 conferences, inclusion of 128. Analysis included keyword mapping, thematic clustering, and temporal overlay. Results: A total of 128 documents were analyzed, resulting in five main thematic clusters: trust and discrimination, family planning, infectious diseases, health literacy, and primary care systems. Temporal evolution shows a shift in focus from medical issues to socio-cultural aspects and community-based policies. Conclusion Cultural sensitivity plays an important role in increasing trust and utilization of adolescent reproductive services. The results of this study provide a basis for the development of inclusive and culturally equitable primary care strategies and policies.</p> Nia Supiana, Oktia Woro Kasmini Handayani, Chatila Maharani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4982 Fri, 07 Nov 2025 00:00:00 +0700 ANALISIS BIBLIOMETRIK INTERVENSI AKTIVITAS FISIK DI TEMPAT KERJA DALAM MENGURANGI PERILAKU SEDENTARY https://proceeding.unnes.ac.id/snk/article/view/4983 <p>Background: Sedentary behavior in the workplace has become a major global health concern, contributing significantly to chronic diseases and reduced productivity. As organizations increasingly emphasize employee well-being, workplace physical activity interventions (WPAIs) have gained prominence as preventive and promotive strategies for occupational health. However, despite growing scholarly attention, comprehensive mapping of research trends and intellectual structures in this field remains limited. Purpose: This study aimed to perform a bibliometric analysis of global research on workplace physical activity interventions to identify publication trends, leading contributors, thematic clusters, and emerging directions. Methods: Using the Scopus database, a total of 690 documents published between 2015 and 2025 were analyzed. Data were processed with VOSviewer to visualize publication patterns, citation structures, author networks, institutional collaboration, and keyword co-occurrence. Results: The analysis revealed a sharp increase in publications over the last decade, with the highest number of papers published in 2021. IJERPH and BMC Public Health were identified as the most productive journals, while the United States, United Kingdom, and Australia dominated global output. Keyword visualization indicated four thematic clusters encompassing sedentary behavior control, biomedical assessment, implementation and policy frameworks, and psychosocial engagement. Conclusions: The findings illustrate the rapid evolution and interdisciplinary research. Theoretically, the study reinforces the Ecological Model of Workplace Wellness, emphasizing multi-level intervention strategies.</p> Sri Maywati, Evi Widowati, Haryono Haryono Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4983 Fri, 07 Nov 2025 00:00:00 +0700 HUBUNGAN ANTARA GAYA KEPEMIMPINAN KEPALA RUANGAN, BUDAYA KESELAMATAN PASIEN, DAN INSIDEN KESELAMATAN PASIEN: SISTEMATIC LITERATURE REVIEW https://proceeding.unnes.ac.id/snk/article/view/4984 <p>This study aims to analyze the relationship between head nurses’ leadership styles, patient safety culture, and patient safety incidents. The study employs a Systematic Literature Review (SLR) approach following the PRISMA guidelines to review 15 articles published between 2020 and 2025. The analysis results indicate that head nurses’ leadership styles play a crucial role in shaping a positive patient safety culture and reducing safety incidents. Transformational, ethical, servant, and coaching leadership styles consistently enhance communication, teamwork, motivation, and open, non-punitive incident reporting. Conversely, authoritarian and laissez-faire leadership styles tend to deteriorate safety culture and reduce reporting levels. Organizational factors such as management support and the implementation of a “just culture” further strengthen the influence of leadership on patient safety. Therefore, improving patient safety depends not only on policies and systems but also on the quality and effectiveness of head nurses’ leadership in fostering a collaborative, communicative, and sustainable safety culture.</p> Ruswati Ruswati, Oktia Woro Kasmini Handayani, Evi Widowati Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4984 Fri, 07 Nov 2025 00:00:00 +0700 ANALISIS INFORMASI DIAGNOSTIK NILAI R-FACTOR GRAPPA MRI PELVIS SEKUEN RESOLVE-DWI KANKER SERVIKS https://proceeding.unnes.ac.id/snk/article/view/4985 <p>Background: Pelvic MRI, particularly the RESOLVE-DWI sequence, plays a crucial role in determining the stage and extent of cancer. However, acquisition time is long and distortion occurs. To overcome this limitation, the parallel imaging technique GRAPPA R-factor with varying R-factors was used. This study aimed to analyze differences in diagnostic information and determine the optimal GRAPPA R-factor value for cervical cancer. Methods: This study was quantitative with an experimental approach. Nine patient samples with variations GRAPPA of 1, 2, and 3 were obtained using a 3 Tesla MRI at Dr. Sardjito General Hospital in Yogyakarta. The images were evaluated by three radiologists based on tumor margin criteria. Data were analyzed using Cohen's Kappa reliability test and Friedman's test to identify differences and determine the best average ranking value. The criteria for tumor expansion and residual tumor were analyzed descriptively. Results: There were significant differences in diagnostic information regarding tumor margins (p-value 0.021). Tumor expansion was found in 7% of cases and residual tumor in 22%. The optimal diagnostic results for GRAPPA 2's R-factor score were 2.61, with the highest average score of 2.61, compared to GRAPPA 1 (1.56) and GRAPPA 3 (1.83). Conclusion: There are differences in the diagnostic information of GRAPPA R-factor variations. GRAPPA R-factor score 2 is recommended as the optimal value for MRI examinations of cervical cancer cases because it produces better diagnostic quality with efficient acquisition time.</p> Darmini Darmini, Nur Khanifa, Asri Indah Aryani, Bambang Budi Raharjo, Mahalul Azam, Intan Zainafree Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4985 Fri, 07 Nov 2025 00:00:00 +0700 Gizi Berbasis Masyarakat Integratif: Strategi Multisektoral untuk Ketahanan Pangan Anak dan Lansia https://proceeding.unnes.ac.id/snk/article/view/4986 <p>Background: Food security for children and the elderly is a complex global issue needing multisectoral, community-based efforts to improve nutrition and well-being. Interventions across health, agriculture, social, and educational sectors can effectively combat malnutrition and insecurity. This study reviews strategies that enhance food security for these vulnerable groups.Methods: A systematic review from 2000 to 2025 used PubMed, Scopus, and Google Scholar to study community based interventions for children and elderly on food security and nutrition. Data analysis identified intervention types, effectiveness, mechanisms, and factors influencing implementation, including facilitators and barriers.Results: Of 15 studies, interventions combining nutrition, behavior change, and social-agricultural support improve nutritional status and food security for children and the elderly. Free meal programs boost child participation, diet quality, and academic performance. Success factors include multisectoral integration, community engagement, and ongoing policy support.Conclusion: Multisectoral, community-based strategies boost food security and nutrition for children and elderly. Cross-sector collaboration and sustained interventions are key for lasting impact.</p> Wahidin Wahidin, Heny Setyawati, Sofwan Indarjo, Dina Nur Anggraini Ningrum Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4986 Fri, 07 Nov 2025 00:00:00 +0700 EFEKTIVITAS LABEL NUTRISI DI BAGIAN DEPAN KEMASAN TERHADAP PERILAKU KONSUMEN DAN PENCEGAHAN PENYAKIT TIDAK MENULAR DI ASIA: LITERATURE REVIEW https://proceeding.unnes.ac.id/snk/article/view/4987 <p>Background: The increasing prevalence of noncommunicable diseases in Asia is driven by high consumption of processed foods. Front-of-package nutrition labeling is a strategy to encourage healthier food choices, but its effectiveness in Asia has not been comprehensively assessed. This study aims to evaluate the effectiveness of nutrition labels in influencing consumer understanding, preferences, and behavior regarding unhealthy foods in Asia. A systematic literature review from PubMed Central®, Scopus, and SAGE (2019–2025) was conducted. A total of 17 articles met the inclusion criteria after identification based on the PRISMA guidelines. Results: Interpretive labels (warnings, traffic lights/TLL, and Nutri-Score) were significantly more effective than numerical labels. Warning labels reduced the purchase intention of sugary drinks by up to 20%, while TLL encouraged healthier choices without increasing costs. Consumer support for nutrition labels was high (&gt;85%), but understanding and effectiveness were influenced by nutrition literacy, socioeconomic context, and policy nature (mandatory vs. voluntary). Industry compliance with voluntary nutrition labels remains low (e.g., only 10% of new products in Thailand). Conclusion: Nutrition labeling is an effective and publicly supported policy tool for preventing noncommunicable diseases in Asia. Successful implementation requires mandatory policies, interpretive labeling systems, nutrition literacy education, and strict industry oversight.</p> Lutfiyah Rizqulloh, Oktia Woro Kasmini Handayani, Eko Farida Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4987 Fri, 07 Nov 2025 00:00:00 +0700 KUALITAS PELAYANAN RADIOLOGI TERHADAP TINGKAT KEPUASAN PASIEN RAWAT JALAN RUMAH SAKIT TIPE B DI JAWA TENGAH https://proceeding.unnes.ac.id/snk/article/view/4988 <p>The number of hospitals in Central Java based on data from the Provincial Health Office in 2024 was 317 hospitals, while there were 63 state hospitals with various types of hospitals. Hospitals continually strive to improve their services in the hope of patient satisfaction, including radiology services. Patient satisfaction is a level of patient feeling that arises as a result of the performance of the health services received after the patient compares it with what he expected. This study was observational with a cross-sectional approach. The population consisted of outpatients undergoing radiology examinations at a type B state hospital in Central Java. The sample consisted of 280 outpatients undergoing routine radiology examinations for internships (PKL) 1, 2, 3, and 4 in the Radiology Study Program in Purwokerto. Data were collected using a questionnaire and then analyzed descriptively using a Cartesian diagram. The results of this study indicate a gap of -0.20, meaning expectations are higher than satisfaction. Meanwhile, the patient satisfaction level is 4.18, indicating satisfaction. The results of the analysis of the Quadrant I Cartesian diagram are that the quality is lower than the customer's wishes so that the radiology installation must improve its quality. The radiology staff are alert in their service, serving patients quickly and accurately, and on time in handling patients. The quality of radiology services at Type B hospitals in Central Java still needs improvement because there is still a negative gap between patient expectations and satisfaction.</p> Dartini Dartini, Mahalul Azam, Evi Widowati, Dina Nur Anggraini Ningrum, Fadli Felayani Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4988 Fri, 07 Nov 2025 00:00:00 +0700 Pengembangan Digital Pasien Safety Sebagai Upaya Pencegahan Infeksi Nosokomial Di Rumah Sakit: Analisis Bibliometrik https://proceeding.unnes.ac.id/snk/article/view/4993 <p>Healthcare-associated infections (HAIs) remain a major challenge in modern healthcare systems, with WHO (2022) reporting prevalence rates of 7–10% among hospitalized patients worldwide. These infections lead to increased morbidity, mortality, extended hospital stays, and rising healthcare costs. The rise of digital health technologies has created significant opportunities for enhancing patient safety programs, particularly in infection prevention through hospital information systems, electronic health records (EHRs), clinical decision support systems (CDSS), and artificial intelligence–based applications. This study aims to analyze international research trends on digital patient safety and nosocomial infection prevention using a bibliometric approach. Data were retrieved from the Scopus database for the period 2019–2024, and analyzed with VOSviewer to map keyword co-occurrence, research clusters, temporal trends, and density visualization. Results indicate a sharp increase in publications during the COVID-19 pandemic, reflecting the accelerated adoption of digital technologies in hospitals. Dominant keywords included infection prevention, patient safety, hospital information system, hand hygiene, and COVID-19. Density mapping revealed research hotspots in digital integration for infection control, but patient feedback systems, communication, and data privacy remain underexplored. This study concludes that digitalization is essential for the future of patient safety; however, its implementation must balance technological innovation with healthcare workers’ behavior, patient engagement, and robust data security regulations.</p> Rizqy Dimas Monica, Evi Widowati, Sri Ratna Rahayu Copyright (c) 2025 https://proceeding.unnes.ac.id/snk/article/view/4993 Fri, 07 Nov 2025 00:00:00 +0700 DUKUNGAN KEHAMILAN HOLISTIK UNTUK MENGURANGI KECEMASAN PADA USIA DINI: ANALISIS BIBLIOMETRIK https://proceeding.unnes.ac.id/snk/article/view/5410 <p>Kecemasan selama kehamilan usia dini menimbulkan tantangan signifikan bagi kesehatan ibu dan janin. Pendekatan perawatan holistik, yang mencakup dimensi fisik, psikologis, sosial, dan spiritual, telah diusulkan sebagai strategi efektif untuk mengurangi kecemasan ini. Studi ini menggunakan analisis bibliometrik dari 20 artikel yang diambil dari basis data Scopus, yang mencakup tahun 2020 hingga Mei 2025. Analisis ini meneliti tren publikasi, sumber jurnal, produktivitas penulis, kata kunci dominan, dan jaringan kolaborasi menggunakan perangkat lunak VOSviewer. Hasil menunjukkan puncak publikasi pada tahun 2022, diikuti penurunan pada tahun 2025, dengan konsentrasi artikel di jurnal ternama seperti Sekolah Kedokteran OHSU. Kata kunci termasuk kehamilan usia dini, kecemasan kehamilan, perawatan holistik, dan dukungan kehamilan. Klaster tematik menyoroti pentingnya dukungan kehamilan dan manajemen kecemasan. Studi ini memberikan gambaran sistematis tentang tren penelitian, mendukung pengembangan model perawatan kehamilan holistik. Laporan ini menekankan pentingnya mengintegrasikan aspek fisik, psikologis, sosial, budaya, dan spiritual dalam dukungan kehamilan untuk mengurangi kecemasan dan meningkatkan kesejahteraan ibu</p> Sri Musfiroh, Widya Hary Cahyati, Eram Tunggul Pawenang Copyright (c) 2026 https://proceeding.unnes.ac.id/snk/article/view/5410 Fri, 07 Nov 2025 00:00:00 +0700